PILRA (NM_178273) Human Untagged Clone
CAT#: SC309258
PILRA (untagged)-Human paired immunoglobin-like type 2 receptor alpha (PILRA), transcript variant 3
"NM_178273" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PILRA |
Synonyms | FDF03 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_178273, the custom clone sequence may differ by one or more nucleotides
ATGGGTCGGCCCCTGCTGCTGCCCCTACTGCCCTTGCTGCTGCCGCCAGCATTTCTGCAGCCTAGTGGCT CCACAGGATCTGGTCCAAGCTACCTTTATGGGGTCACTCAACCAAAACACCTCTCAGCCTCCATGGGTGG CTCTGTGGAAATCCCCTTCTCCTTCTATTACCCCTGGGAGTTAGCCACAGCTCCCGACGTGAGAATATCC TGGAGACGGGGCCACTTCCACAGGCAGTCCTTCTACAGCACAAGGCCGCCTTCCATTCACAAGGATTATG TGAACCGGCTCTTTCTGAACTGGACAGAGGGTCAGAAGAGCGGCTTCCTCAGGATCTCCAACCTGCAGAA GCAGGACCAGTCTGTGTATTTCTGCCGAGTTGAGCTGGACACACGGAGCTCAGGGAGGCAGCAGTGGCAG TCCATCGAGGGGACCAAACTCTCCATCACCCAGGGGAACCCTTCCAAAACACAGAGGAGCCATATGAGAA TATCAGGAATGAAGGACAAAATACAGATCCCAAGCTAA |
Chromatograms |
CHROMATOGRAMS
Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_178273 |
ORF Size | 528 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_178273.1, NP_840057.1 |
RefSeq Size | 1070 |
RefSeq ORF | 528 |
Locus ID | 29992 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | Cell signaling pathways rely on a dynamic interaction between activating and inhibiting processes. SHP-1-mediated dephosphorylation of protein tyrosine residues is central to the regulation of several cell signaling pathways. Two types of inhibitory receptor superfamily members are immunoreceptor tyrosine-based inhibitory motif (ITIM)-bearing receptors and their non-ITIM-bearing, activating counterparts. Control of cell signaling via SHP-1 is thought to occur through a balance between PILRalpha-mediated inhibition and PILRbeta-mediated activation. These paired immunoglobulin-like receptor genes are located in a tandem head-to-tail orientation on chromosome 7. This particular gene encodes the ITIM-bearing member of the receptor pair, which functions in the inhibitory role. Alternative splicing has been observed at this locus and three variants, each encoding a distinct isoform, are described. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) lacks two internal coding exons, compared to variant 1, which causes a frameshift and results in the shortest isoform (3) that has a distinct C-terminus, compared to isoform 1. Isoform 3 is thought to be a soluble protein, since it lacks the transmembrane domain found in isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC220244 | PILRA (Myc-DDK-tagged)-Human paired immunoglobin-like type 2 receptor alpha (PILRA), transcript variant 3 |
USD 420.00 |
|
RG220244 | PILRA (GFP-tagged) - Human paired immunoglobin-like type 2 receptor alpha (PILRA), transcript variant 3 |
USD 460.00 |
|
RC220244L3 | Lenti ORF clone of Human paired immunoglobin-like type 2 receptor alpha (PILRA), transcript variant 3, Myc-DDK-tagged |
USD 620.00 |
|
RC220244L4 | Lenti ORF clone of Human paired immunoglobin-like type 2 receptor alpha (PILRA), transcript variant 3, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review