PILRA (NM_178273) Human Untagged Clone

CAT#: SC309258

PILRA (untagged)-Human paired immunoglobin-like type 2 receptor alpha (PILRA), transcript variant 3


  "NM_178273" in other vectors (4)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "PILRA"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PILRA
Synonyms FDF03
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_178273, the custom clone sequence may differ by one or more nucleotides


ATGGGTCGGCCCCTGCTGCTGCCCCTACTGCCCTTGCTGCTGCCGCCAGCATTTCTGCAGCCTAGTGGCT
CCACAGGATCTGGTCCAAGCTACCTTTATGGGGTCACTCAACCAAAACACCTCTCAGCCTCCATGGGTGG
CTCTGTGGAAATCCCCTTCTCCTTCTATTACCCCTGGGAGTTAGCCACAGCTCCCGACGTGAGAATATCC
TGGAGACGGGGCCACTTCCACAGGCAGTCCTTCTACAGCACAAGGCCGCCTTCCATTCACAAGGATTATG
TGAACCGGCTCTTTCTGAACTGGACAGAGGGTCAGAAGAGCGGCTTCCTCAGGATCTCCAACCTGCAGAA
GCAGGACCAGTCTGTGTATTTCTGCCGAGTTGAGCTGGACACACGGAGCTCAGGGAGGCAGCAGTGGCAG
TCCATCGAGGGGACCAAACTCTCCATCACCCAGGGGAACCCTTCCAAAACACAGAGGAGCCATATGAGAA
TATCAGGAATGAAGGACAAAATACAGATCCCAAGCTAA


Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_178273
ORF Size 528 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_178273.1, NP_840057.1
RefSeq Size 1070
RefSeq ORF 528
Locus ID 29992
Protein Families Druggable Genome, Transmembrane
Gene Summary Cell signaling pathways rely on a dynamic interaction between activating and inhibiting processes. SHP-1-mediated dephosphorylation of protein tyrosine residues is central to the regulation of several cell signaling pathways. Two types of inhibitory receptor superfamily members are immunoreceptor tyrosine-based inhibitory motif (ITIM)-bearing receptors and their non-ITIM-bearing, activating counterparts. Control of cell signaling via SHP-1 is thought to occur through a balance between PILRalpha-mediated inhibition and PILRbeta-mediated activation. These paired immunoglobulin-like receptor genes are located in a tandem head-to-tail orientation on chromosome 7. This particular gene encodes the ITIM-bearing member of the receptor pair, which functions in the inhibitory role. Alternative splicing has been observed at this locus and three variants, each encoding a distinct isoform, are described. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) lacks two internal coding exons, compared to variant 1, which causes a frameshift and results in the shortest isoform (3) that has a distinct C-terminus, compared to isoform 1. Isoform 3 is thought to be a soluble protein, since it lacks the transmembrane domain found in isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.