TMEM107 (NM_183065) Human Untagged Clone

CAT#: SC309339

TMEM107 (untagged)-Human transmembrane protein 107 (TMEM107), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TMEM107
• Synonyms: GRVS638; JBTS29; MKS13; PRO1268
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_183065, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGCCGGGTCTCAGGGCTTGTGCCCTCTCGCTTCCTGACGCTCCTGGCGCATCTGGTGGTCGTCATCA
  CCTTATTCTGGTCCCGGGACAGCAACATACAGGCCTGCCTGCCTCTCACGTTCACCCCCGAGGAGTATGA
  CAAGCAGGACATTCAGCTGGTGGCCGCGCTCTCTGTCACCCTGGGCCTCTTTGCAGTGGAGCTGGCCGGT
  TTCCTCTCAGGAGTCTCCATGTTCAACAGCACCCAGAGCCTCATCTCCATTGGGGCTCACTGTAGTGCAT
  CCGTGGCCCTGTCCTTCTTCATATTCGAGCGTTGGGAGTGCACTACGTATTGGTACATTTTTGTCTTCTG
  CAGTGCCCTTCCAGCTGTCACTGAAATGGCTTTATTCGTCACCGTCTTTGGGCTGAAAAAGAAACCCTTC
  TGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_183065
• ORF Size: 423 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_183065.2, NP_898888.1
• RefSeq Size: 1758
• RefSeq ORF: 423
• Locus ID: 84314
• Protein Families: Transmembrane
• Gene Summary: This gene encodes a transmembrane protein and component of the primary cilia transition zone. The encoded protein regulates ciliogenesis and ciliary protein composition. Human fibroblasts expressing a mutant allele of this gene exhibit reduced numbers of cilia, altered cilia length, and impaired sonic hedgehog signaling. In human patients, different mutations in this gene cause different ciliopathies, including Meckel-Gruber syndrome and orofaciodigital syndrome. [provided by RefSeq, May 2017]
  Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 5' coding region compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.