RAB15 (NM_198686) Human Untagged Clone
CAT#: SC309391
RAB15 (untagged)-Human RAB15, member RAS onocogene family (RAB15)
"NM_198686" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | RAB15 |
Synonyms | RAB15, member RAS oncogene family; RAB15, member RAS onocogene family; Ras-related protein Rab-15 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_198686, the custom clone sequence may differ by one or more nucleotides
ATGGCGAAGCAGTACGATGTGCTGTTCCGGCTGCTGCTGATCGGGGACTCCGGGGTGGGCAAGACCTGCC TGCTGTGCCGCTTCACCGACAACGAGTTCCACTCCTCGCACATCTCCACCATCGGTGTTGACTTTAAGAT GAAGACCATAGAGGTAGACGGCATCAAAGTGCGGATACAGATCTGGGACACTGCAGGGCAGGAGAGATAC CAGACCATCACAAAGCAGTACTATCGGCGGGCCCAGGGGATATTTTTGGTCTATGACATTAGCAGCGAGC GCTCTTACCAGCACATCATGAAGTGGGTCAGTGACGTGGATGAGGTAGGAGATGCCACCTCACTGCCGGG GTGTGGAGAGGGTGCCTCACCGGGGAAGGCAAGGCGAGGGCCAGATGGGAAGGCAAATGCTTCCAGGAAG CTTTGCCTTCCACAGCCCTGGATGAAGACCTCTGGTACGCACCAGAAGGCGTCCAGAAGATCCTTATTGG GAATAAGGCTGATGAGGAGCAGAAACGGCAGGTGGGAAGAGAGCAAGGGCAGCAGCTGGCGAAGGAGTAT GGCATGGACTTCTATGAAACAAGTGCCTGCACCAACCTCAACATTAAAGAGTCATTCACGCGTCTGA |
Restriction Sites | SgfI-RsrII |
ACCN | NM_198686 |
ORF Size | 627 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_198686.2, NP_941959.1 |
RefSeq Size | 3411 |
RefSeq ORF | 627 |
Locus ID | 376267 |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC207259 | RAB15 (Myc-DDK-tagged)-Human RAB15, member RAS onocogene family (RAB15) |
USD 98.00 |
|
RG207259 | RAB15 (GFP-tagged) - Human RAB15, member RAS onocogene family (RAB15) |
USD 460.00 |
|
RC207259L1 | Lenti ORF clone of Human RAB15, member RAS onocogene family (RAB15), Myc-DDK-tagged |
USD 620.00 |
|
RC207259L2 | Lenti ORF clone of Human RAB15, member RAS onocogene family (RAB15), mGFP tagged |
USD 620.00 |
|
RC207259L3 | Lenti ORF clone of Human RAB15, member RAS onocogene family (RAB15), Myc-DDK-tagged |
USD 620.00 |
|
RC207259L4 | Lenti ORF clone of Human RAB15, member RAS onocogene family (RAB15), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review