CAMK2B (NM_172083) Human Untagged Clone
CAT#: SC309415
CAMK2B (untagged)-Human calcium/calmodulin-dependent protein kinase II beta (CAMK2B), transcript variant 7
"NM_172083" in other vectors (4)
Product Images
![](https://origeneresource2.s3.us-east-2.amazonaws.com/cmsstatics/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CAMK2B |
Synonyms | CAM2; CAMK2; CAMKB; MRD54 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_172083, the custom clone sequence may differ by one or more nucleotides
ATGGCCACCACGGTGACCTGCACCCGCTTCACCGACGAGTACCAGCTCTACGAGGATATTGGCAAGGGGG CTTTCTCTGTGGTCCGACGCTGTGTCAAGCTCTGCACCGGCCATGAGTATGCAGCCAAGATCATCAACAC CAAGAAGCTGTCAGCCAGAGATCACCAGAAGCTGGAGAGAGAGGCTCGGATCTGCCGCCTTCTGAAGCAT TCCAACATCGTGCGTCTCCACGACAGCATCTCCGAGGAGGGCTTCCACTACCTGGTCTTCGATCTGGTCA CTGGTGGGGAGCTCTTTGAAGACATTGTGGCGAGAGAGTACTACAGCGAGGCTGATGCCAGTCACTGTAT CCAGCAGATCCTGGAGGCCGTTCTCCATTGTCACCAAATGGGGGTCGTCCACAGAGACCTCAAGCCGGAG AACCTGCTTCTGGCCAGCAAGTGCAAAGGGGCTGCAGTGAAGCTGGCAGACTTCGGCCTAGCTATCGAGG TGCAGGGGGACCAGCAGGCATGGTTTGGTTTCGCTGGCACACCAGGCTACCTGTCCCCTGAGGTCCTTCG CAAAGAGGCGTATGGCAAGCCTGTGGACATCTGGGCATGTGGGGTGATCCTGTACATCCTGCTCGTGGGC TACCCACCCTTCTGGGACGAGGACCAGCACAAGCTGTACCAGCAGATCAAGGCTGGTGCCTATGACTTCC CGTCCCCTGAGTGGGACACCGTCACTCCTGAAGCCAAAAACCTCATCAACCAGATGCTGACCATCAACCC TGCCAAGCGCATCACAGCCCATGAGGCCCTGAAGCACCCGTGGGTCTGCCAACGCTCCACGGTAGCATCC ATGATGCACAGACAGGAGACTGTGGAGTGTCTGAAAAAGTTCAATGCCAGGAGAAAGCTCAAGGGAGCCA TCCTCACCACCATGCTGGCCACACGGAATTTCTCAGCAGCCAAGAGTTTACTCAACAAGAAAGCAGATGG AGTCAAGGAGTCTTCTGACAGTGCCAATACCACCATAGAGGATGAAGACGCTAAAGCCCGGAAGCAGGAG ATCATTAAGACCACGGAGCAGCTCATCGAGGCCGTCAACAACGGTGACTTTGAGGCCTACGCGAAAATCT GTGACCCAGGGCTGACCTCGTTTGAGCCTGAAGCACTGGGCAACCTGGTTGAAGGGATGGACTTCCACAG ATTCTACTTCGAGAACCTGCTGGCCAAGAACAGCAAGCCGATCCACACGACCATCCTGAACCCACACGTG CACGTCATTGGAGAGGATGCCGCCTGCATCGCTTACATCCGGCTCACGCAGTACATTGACGGGCAGGGCC GGCCCCGCACCAGCCAGTCTGAGGAGACCCGCGTGTGGCACCGCCGCGACGGCAAGTGGCAGAACGTGCA CTTCCACTGCTCGGGCGCGCCTGTGGCCCCGCTGCAGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_172083 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_172083.2, NP_742080.1 |
RefSeq Size | 4025 bp |
RefSeq ORF | 1440 bp |
Locus ID | 816 |
Cytogenetics | 7p13 |
Protein Families | Druggable Genome, Protein Kinase |
Protein Pathways | Calcium signaling pathway, ErbB signaling pathway, Glioma, GnRH signaling pathway, Long-term potentiation, Melanogenesis, Neurotrophin signaling pathway, Olfactory transduction, Oocyte meiosis, Wnt signaling pathway |
Gene Summary | 'The product of this gene belongs to the serine/threonine protein kinase family and to the Ca(2+)/calmodulin-dependent protein kinase subfamily. Calcium signaling is crucial for several aspects of plasticity at glutamatergic synapses. In mammalian cells, the enzyme is composed of four different chains: alpha, beta, gamma, and delta. The product of this gene is a beta chain. It is possible that distinct isoforms of this chain have different cellular localizations and interact differently with calmodulin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]' Transcript Variant: This variant (7), also known as beta 2, lacks an in-frame segment of the coding region, compared to variant 1. It encodes a shorter isoform (7), also known as beta 2 subunit, that is missing an internal segment compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC216552 | CAMK2B (Myc-DDK-tagged)-Human calcium/calmodulin-dependent protein kinase II beta (CAMK2B), transcript variant 7 |
USD 420.00 |
|
RG216552 | CAMK2B (GFP-tagged) - Human calcium/calmodulin-dependent protein kinase II beta (CAMK2B), transcript variant 7 |
USD 460.00 |
|
RC216552L3 | Lenti-ORF clone of CAMK2B (Myc-DDK-tagged)-Human calcium/calmodulin-dependent protein kinase II beta (CAMK2B), transcript variant 7 |
USD 620.00 |
|
RC216552L4 | Lenti-ORF clone of CAMK2B (mGFP-tagged)-Human calcium/calmodulin-dependent protein kinase II beta (CAMK2B), transcript variant 7 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review