APAF1 (NM_181869) Human Untagged Clone

CAT#: SC309446

APAF1 (untagged)-Human apoptotic peptidase activating factor 1 (APAF1), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: APAF1
• Synonyms: APAF-1; CED4
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_181869, the custom clone sequence may differ by one or more nucleotides
  ATGGATGCAAAAGCTCGAAATTGTTTGCTTCAACATAGAGAAGCTCTGGAAAAGGACATC
  AAGACATCCTACATCATGGATCACATGATTAGTGATGGATTTTTAACAATATCAGAAGAG
  GAAAAAGTAAGAAATGAGCCCACTCAACAGCAAAGAGCAGCTATGCTGATTAAAATGATA
  CTTAAAAAAGATAATGATTCCTACGTATCATTCTACAATGCTCTACTACATGAAGGATAT
  AAAGATCTTGCTGCCCTTCTCCATGATGGCATTCCTGTTGTCTCTTCTTCCAGTGGTAAA
  GATTCAGTTAGTGGAATAACTTCGTATGTAAGGACAGTCCTGTGTGAAGGTGGAGTACCA
  CAGAGGCCAGTTGTTTTTGTCACAAGGAAGAAGCTGGTGAATGCAATTCAGCAGAAGCTC
  TCCAAATTGAAAGGTGAACCAGGATGGGTCACCATACATGGAATGGCAGGCTGTGGGAAG
  TCTGTATTAGCTGCAGAAGCTGTTAGAGATCATTCCCTTTTAGAAGGTTGTTTCCCAGGG
  GGAGTGCATTGGGTTTCAGTTGGGAAACAAGACAAATCTGGGCTTCTGATGAAACTGCAG
  AATCTTTGCACACGGTTGGATCAGGATGAGAGTTTTTCCCAGAGGCTTCCACTTAATATT
  GAAGAGGCTAAAGACCGTCTCCGCATTCTGATGCTTCGCAAACACCCAAGGTCTCTCTTG
  ATCTTGGATGATGTTTGGGACTCTTGGGTGTTGAAAGCTTTTGACAGTCAGTGTCAGATT
  CTTCTTACAACCAGAGACAAGAGTGTTACAGATTCAGTAATGGGTCCTAAATATGTAGTC
  CCTGTGGAGAGTTCCTTAGGAAAGGAAAAAGGACTTGAAATTTTATCCCTTTTTGTTAAT
  ATGAAGAAGGCAGATTTGCCAGAACAAGCTCATAGTATTATAAAAGAATGTAAAGTGGTG
  GAACGTTGTCACTGGGGAATCCTCACAGACCTTCTACACAAATGGAACCAATCTTAA
  
• Restriction Sites: Please inquire
• ACCN: NM_181869
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_181869.1, NP_863659.1
• RefSeq Size: 4559 bp
• RefSeq ORF: 1017 bp
• Locus ID: 317
• Cytogenetics: 12q23.1
• Protein Families: Druggable Genome
• Protein Pathways: Alzheimer's disease, Amyotrophic lateral sclerosis (ALS), Apoptosis, Huntington's disease, p53 signaling pathway, Parkinson's disease, Small cell lung cancer
• Gene Summary: 'This gene encodes a cytoplasmic protein that initiates apoptosis. This protein contains several copies of the WD-40 domain, a caspase recruitment domain (CARD), and an ATPase domain (NB-ARC). Upon binding cytochrome c and dATP, this protein forms an oligomeric apoptosome. The apoptosome binds and cleaves caspase 9 preproprotein, releasing its mature, activated form. Activated caspase 9 stimulates the subsequent caspase cascade that commits the cell to apoptosis. Alternative splicing results in several transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (5), also known as APAF-1-ALT, lacks several exons in the coding sequence, resulting in a frameshift and an early termination codon compared to variant 3. Variant 5 encodes isoform e, which is shorter and has a distinct C-terminus compared to isoform c.