Cathepsin E (CTSE) (NM_148964) Human Untagged Clone

CAT#: SC309487

CTSE (untagged)-Human cathepsin E (CTSE), transcript variant 2


  "NM_148964" in other vectors (4)

Reconstitution Protocol

USD 630.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "CTSE"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CTSE
Synonyms CATE
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_148964, the custom clone sequence may differ by one or more nucleotides


ATGAAAACGCTCCTTCTTTTGCTGCTGGTGCTCCTGGAGCTGGGAGAGGCCCAAGGATCCCTTCACAGGG
TGCCCCTCAGGAGGCATCCGTCCCTCAAGAAGAAGCTGCGGGCACGGAGCCAGCTCTCTGAGTTCTGGAA
ATCCCATAATTTGGACATGATCCAGTTCACCGAGTCCTGCTCAATGGACCAGAGTGCCAAGGAACCCCTC
ATCAACTACTTGGATATGGAATACTTCGGCACTATCTCCATTGGCTCCCCACCACAGAACTTCACTGTCA
TCTTCGACACTGGCTCCTCCAACCTCTGGGTCCCCTCTGTGTACTGCACTAGCCCAGCCTGCAAGACGCA
CAGCAGGTTCCAGCCTTCCCAGTCCAGCACATACAGCCAGCCAGGTCAATCTTTCTCCATTCAGTATGGA
ACCGGGAGCTTGTCCGGGATCATTGGAGCCGACCAAGTCTCTGTGGAAGGACTAACCGTGGTTGGCCAGC
AGTTTGGAGAAAGTGTCACAGAGCCAGGCCAGACCTTTGTGGATGCAGAGTTTGATGGAATTCTGGGCCT
GGGATACCCCTCCTTGGCTGTGGGAGGAGTGACTCCAGTATTTGACAACATGATGGCTCAGAACCTGGTG
GACTTGCCGATGTTTTCTGTCTACATGAGCAGTAACCCAGAAGGTGGTGCGGGGAGCGAGCTGATTTTTG
GAGGCTACGACCACTCCCATTTCTCTGGGAGCCTGAATTGGGTCCCAGTCACCAAGCAAGCTTACTGGCA
GATTGCACTGGATAATATGCTGTGGAGTGTGCCAACCTTAACGTCATGCCGGATGTCACCTTCACCATTA
ACGGAGTCCCCTATACCCTCAGCCCAACTGCCTACACCCTACTGGACTTCGTGGATGGAATGCAGTTCTG
CAGCAGTGGCTTTCAAGGACTTGACATCCACCCTCCAGCTGGGCCCCTCTGGATCCTGGGGGATGTCTTC
ATTCGACAGTTTTACTCAGTCTTTGACCGTGGGAATAACCGTGTGGGACTGGCCCCAGCAGTCCCCTAAG
GAGGGGCCTTGTGTCTGTGCCTGCCTGTCTGACAGACCTTGA


Restriction Sites SgfI-MluI     
ACCN NM_148964
ORF Size 1092 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_148964.2, NP_683865.1
RefSeq Size 2180
RefSeq ORF 1092
Locus ID 1510
Protein Families Druggable Genome, Protease
Protein Pathways Lysosome
Gene Summary This gene encodes a member of the A1 family of peptidases. Alternative splicing of this gene results in multiple transcript variants. At least one of these variants encodes a preproprotein that is proteolytically processed to generate the mature enzyme. This enzyme, an aspartic endopeptidase, may be involved in antigen processing and the maturation of secretory proteins. Elevated expression of this gene has been observed in neurodegeneration. [provided by RefSeq, Nov 2015]
Transcript Variant: This variant (2) lacks an alternate exon in the 3' coding region resulting in a frameshift compared to variant 1. The encoded isoform (b) is shorter and has a distinct C-terminus compared to isoform a. This isoform (b) may undergo proteolytic processing but exhibits reduced enzymatic activity compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.