DYRK1A (NM_101395) Human Untagged Clone
CAT#: SC309491
DYRK1A (untagged)-Human dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A (DYRK1A), transcript variant 3
"NM_101395" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | DYRK1A |
Synonyms | DYRK; DYRK1; HP86; MNB; MNBH; MRD7 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_101395, the custom clone sequence may differ by one or more nucleotides
ATGCATACAGGAGGAGAGACTTCAGCATGCAAACCTTCATCTGTTCGGCTTGCACCGTCA TTTTCATTCCATGCTGCTGGCCTTCAGATGGCTGGACAGATGCCCCATTCACATCAGTAC AGTGACCGTCGCCAGCCAAACATAAGTGACCAACAGGTTTCTGCCTTATCATATTCTGAC CAGATTCAGCAACCTCTAACTAACCAGGTGATGCCTGATATTGTCATGTTACAGAGGCGG ATGCCCCAAACCTTCCGTGACCCAGCAACTGCTCCCCTGAGAAAACTTTCTGTTGACTTG ATCAAAACATACAAGCATATTAATGAGGTTTACTATGCAAAAAAGAAGCGAAGACACCAA CAGGGCCAGGGAGACGATTCTAGTCATAAGAAGGAACGGAAGGTTTACAATGATGGTTAT GATGATGATAACTATGATTATATTGTAAAAAACGGAGAAAAGTGGATGGATCGTTACGAA ATTGACTCCTTGATAGGCAAAGGTTCCTTTGGACAGGTTGTAAAGGCATATGATCGTGTG GAGCAAGAATGGGTTGCCATTAAAATAATAAAGAACAAGAAGGCTTTTCTGAATCAAGCA CAGATAGAAGTGCGACTTCTTGAGCTCATGAACAAACATGACACTGAAATGAAATACTAC ATAGTGCATTTGAAACGCCACTTTATGTTTCGAAACCATCTCTGTTTAGTTTTTGAAATG CTGTCCTACAACCTCTATGACTTGCTGAGAAACACCAATTTCCGAGGGGTCTCTTTGAAC CTAACACGAAAGTTTGCGCAACAGATGTGCACTGCACTGCTTTTCCTTGCGACTCCAGAA CTTAGTATCATTCACTGTGATCTAAAACCTGAAAATATCCTTCTTTGTAACCCCAAACGC AGTGCAATCAAGATAGTTGACTTTGGCAGTTCTTGTCAGTTGGGGCAGAGGATATACCAG TATATTCAGAGTCGCTTTTATCGGTCTCCAGAGGTGCTACTGGGAATGCCTTATGACCTT GCCATTGATATGTGGTCCCTCGGGTGTATTTTGGTTGAAATGCACACTGGAGAACCTCTG TTCAGTGGTGCCAATGAGGTAGATCAGATGAATAAAATAGTGGAAGTTCTGGGTATTCCA CCTGCTCATATTCTTGACCAAGCACCAAAAGCAAGAAAGTTCTTTGAGAAGTTGCCAGAT GGCACTTGGAACTTAAAGAAGACCAAAGATGGAAAACGGGAGTACAAACCACCAGGAACC CGTAAACTTCATAACATTCTTGGAGTGGAAACAGGAGGACCTGGTGGGCGACGTGCTGGG GAGTCAGGTCATACGGTCGCTGACTACTTGAAGTTCAAAGACCTCATTTTAAGGATGCTT GATTATGACCCCAAAACTCGAATTCAACCTTATTATGCTCTGCAGCACAGTTTCTTCAAG AAAACAGCTGATGAAGGTACAAATACAAGTAATAGTGTATCTACAAGCCCCGCCATGGAG CAGTCTCAGTCTTCGGGCACCACCTCCAGTACATCGTCAAGCTCAGGTGGCTCATCGGGG ACAAGCAACAGTGGGAGAGCCCGGTCGGATCCGACGCACCAGCATCGGCACAGTGGTGGG CACTTCACAGCTGCCGTGCAGGCCATGGACTGCGAGACACACAGTCCCCAGGTGAGCTCG CACGTGGTTCATTTGCTTGTGTCACCTGCCATTCTCAGGTGGAGCAGCACTGGATGCCAG GTGCCTTTAGAATGA |
Restriction Sites | Please inquire |
ACCN | NM_101395 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_101395.1, NP_567824.1 |
RefSeq Size | 5315 bp |
RefSeq ORF | 1755 bp |
Locus ID | 1859 |
Cytogenetics | 21q22.13 |
Protein Families | Druggable Genome, Protein Kinase |
Gene Summary | 'This gene encodes a member of the Dual-specificity tyrosine phosphorylation-regulated kinase (DYRK) family. This member contains a nuclear targeting signal sequence, a protein kinase domain, a leucine zipper motif, and a highly conservative 13-consecutive-histidine repeat. It catalyzes its autophosphorylation on serine/threonine and tyrosine residues. It may play a significant role in a signaling pathway regulating cell proliferation and may be involved in brain development. This gene is a homolog of Drosophila mnb (minibrain) gene and rat Dyrk gene. It is localized in the Down syndrome critical region of chromosome 21, and is considered to be a strong candidate gene for learning defects associated with Down syndrome. Alternative splicing of this gene generates several transcript variants differing from each other either in the 5' UTR or in the 3' coding region. These variants encode at least five different isoforms. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (3) is alternatively spliced in the 5' UTR and in the 3' coding region, as compared to variant 1. It encodes a 179 aa shorter isoform which lacks the poly-His domain and has a different C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215138 | DYRK1A (Myc-DDK-tagged)-Human dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A (DYRK1A), transcript variant 3 |
USD 540.00 |
|
RG215138 | DYRK1A (GFP-tagged) - Human dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A (DYRK1A), transcript variant 3 |
USD 590.00 |
|
RC215138L3 | Lenti-ORF clone of DYRK1A (Myc-DDK-tagged)-Human dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A (DYRK1A), transcript variant 3 |
USD 740.00 |
|
RC215138L4 | Lenti-ORF clone of DYRK1A (mGFP-tagged)-Human dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A (DYRK1A), transcript variant 3 |
USD 740.00 |
{0} Product Review(s)
Be the first one to submit a review