IL11RA (NM_147162) Human Untagged Clone
CAT#: SC309505
IL11RA (untagged)-Human interleukin 11 receptor, alpha (IL11RA), transcript variant 2
"NM_147162" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | IL11RA |
Synonyms | CRSDA |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_147162, the custom clone sequence may differ by one or more nucleotides
ATGAGCAGCAGCTGCTCAGGGCTGAGCAGGGTCCTGGTGGCCGTGGCTACAGCCCTGGTGTCTGCCTCCT CCCCCTGCCCCCAGGCCTGGGGCCCCCCAGGGGTCCAGTATGGGCAGCCAGGCAGGTCCGTGAAGCTGTG TTGTCCTGGAGTGACTGCCGGGGACCCAGTGTCCTGGTTTCGGGATGGGGAGCCAAAGCTGCTCCAGGGA CCTGACTCTGGGCTAGGGCATGAACTGGTCCTGGCCCAGGCAGACAGCACTGATGAGGGCACCTACATCT GCCAGACCCTGGATGGTGCACTTGGGGGCACAGTGACCCTGCAGCTGGGCTACCCTCCAGCCCGCCCTGT TGTCTCCTGCCAAGCAGCCGACTATGAGAACTTCTCTTGCACTTGGAGTCCCAGCCAGATCAGCGGTTTA CCCACCCGCTACCTCACCTCCTACAGGAAGAAGACAGTCCTAGGAGCTGATAGCCAGAGGAGGAGTCCAT CCACAGGGCCCTGGCCATGCCCACAGGATCCCCTAGGGGCTGCCCGCTGTGTTGTCCACGGGGCTGAGTT CTGGAGCCAGTACCGGATTAATGTGACTGAGGTGAACCCACTGGGTGCCAGCACACGCCTGCTGGATGTG AGCTTGCAGAGCATCTTGCGCCCTGACCCACCCCAGGGCCTGCGGGTAGAGTCAGTACCAGGTTACCCCC GACGCCTGCGAGCCAGCTGGACATACCCTGCCTCCTGGCCGTGCCAGCCCCACTTCCTGCTCAAGTTCCG TTTGCAGTACCGTCCGGCGCAGCATCCAGCCTGGTCCACGGTGGAGCCAGCTGGACTGGAGGAGGTGATC ACAGATGCTGTGGCTGGGCTGCCCCATGCTGTACGAGTCAGTGCCCGGGACTTTCTAGATGCTGGCACCT GGAGCACCTGGAGCCCGGAGGCCTGGGGAACTCCGAGCACTGGGACCATACCAAAGGAGATACCAGCATG GGGCCAGCTACACACGCAGCCAGAGGTGGAGCCTCAGGTGGACAGCCCTGCTCCTCCAAGGCCCTCCCTC CAACCACACCCTCGGCTACTTGATCACAGGGACTCTGTGGAGCAGGTAGCTGTGCTGGCGTCTTTGGGAA TCCTTTCTTTCCTGGGACTGGTGGCTGGGGCCCTGGCACTGGGGCTCTGGTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_147162 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_147162.1, NP_671518.1 |
RefSeq Size | 1458 bp |
RefSeq ORF | 1173 bp |
Locus ID | 3590 |
Cytogenetics | 9p13.3 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Cytokine-cytokine receptor interaction, Hematopoietic cell lineage, Jak-STAT signaling pathway |
Gene Summary | 'Interleukin 11 is a stromal cell-derived cytokine that belongs to a family of pleiotropic and redundant cytokines that use the gp130 transducing subunit in their high affinity receptors. This gene encodes the IL-11 receptor, which is a member of the hematopoietic cytokine receptor family. This particular receptor is very similar to ciliary neurotrophic factor, since both contain an extracellular region with a 2-domain structure composed of an immunoglobulin-like domain and a cytokine receptor-like domain. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2012]' Transcript Variant: This variant (2) skips a splice site utilized by variant 1 and immediately encounters a stop codon. The encoded isoform (2) is a shorter, truncated isoform compared to isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219348 | IL11RA (Myc-DDK-tagged)-Human interleukin 11 receptor, alpha (IL11RA), transcript variant 2 |
USD 420.00 |
|
RG219348 | IL11RA (GFP-tagged) - Human interleukin 11 receptor, alpha (IL11RA), transcript variant 2 |
USD 460.00 |
|
RC219348L3 | Lenti-ORF clone of IL11RA (Myc-DDK-tagged)-Human interleukin 11 receptor, alpha (IL11RA), transcript variant 2 |
USD 620.00 |
|
RC219348L4 | Lenti-ORF clone of IL11RA (mGFP-tagged)-Human interleukin 11 receptor, alpha (IL11RA), transcript variant 2 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review