PACE4 (PCSK6) (NM_138322) Human Untagged Clone

CAT#: SC309534

PCSK6 (untagged)-Human proprotein convertase subtilisin/kexin type 6 (PCSK6), transcript variant 3


  "NM_138322" in other vectors (6)

Reconstitution Protocol

USD 820.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PCSK6"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PCSK6
Synonyms PACE4; SPC4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_138322, the custom clone sequence may differ by one or more nucleotides


ATGCCTCCGCGCGCGCCGCCTGCGCCCGGGCCCCGGCCGCCGCCCCGGGCCGCCGCCGCCACCGACACCG
CCGCGGGCGCGGGGGGCGCGGGGGGCGCGGGGGGCGCCGGCGGGCCCGGGTTCCGGCCGCTCGCGCCGCG
TCCCTGGCGCTGGCTGCTGCTGCTGGCGCTGCCTGCCGCCTGCTCCGCGCCCCCGCCGCGCCCCGTCTAC
ACCAACCACTGGGCGGTGCAAGTGCTGGGCGGCCCGGCCGAGGCGGACCGCGTGGCGGCGGCGCACGGGT
ACCTCAACTTGGGCCAGATTGGAAACCTGGAAGATTACTACCATTTTTATCACAGCAAAACCTTTAAAAG
ATCAACCTTGAGTAGCAGAGGCCCTCACACCTTCCTCAGAATGGACCCCCAGGTGAAATGGCTCCAGCAA
CAGGAAGTGAAACGAAGGGTGAAGAGACAGGTGCGAAGTGACCCGCAGGCCCTTTACTTCAACGACCCCA
TTTGGTCCAACATGTGGTACCTGCATTGTGGCGACAAGAACAGTCGCTGCCGGTCGGAAATGAATGTCCA
GGCAGCGTGGAAGAGGGGCTACACAGGAAAAAACGTGGTGGTCACCATCCTTGATGATGGCATAGAGAGA
AATCACCCTGACCTGGCCCCAAATTATGATTCCTACGCCAGCTACGACGTGAACGGCAATGATTATGACC
CATCTCCACGATATGATGCCAGCAATGAAAATAAACACGGCACTCGTTGTGCGGGAGAAGTTGCTGCTTC
AGCAAACAATTCCTACTGCATCGTGGGCATAGCGTACAATGCCAAAATAGGAGGCATCCGCATGCTGGAC
GGCGATGTCACAGATGTGGTCGAGGCAAAGTCGCTGGGCATCAGACCCAACTACATCGACATTTACAGTG
CCAGCTGGGGGCCGGACGACGACGGCAAGACGGTGGACGGGCCCGGCCGACTGGCTAAGCAGGCTTTCGA
GTATGGCATTAAAAAGGGCCGGCAGGGCCTGGGCTCCATTTTCGTCTGGGCATCTGGGAATGGCGGGAGA
GAGGGGGACTACTGCTCGTGCGATGGCTACACCAACAGCATCTACACCATCTCCGTCAGCAGCGCCACCG
AGAATGGCTACAAGCCCTGGTACCTGGAAGAGTGTGCCTCCACCCTGGCCACCACCTACAGCAGTGGGGC
CTTTTATGAGCGAAAAATCGTCACCACGGATCTGCGTCAGCGCTGTACCGATGGCCACACTGGGACCTCA
GTCTCTGCCCCCATGGTGGCGGGCATCATCGCCTTGGCTCTAGAAGCAAACAGCCAGTTAACCTGGAGGG
ACGTCCAGCACCTGCTAGTGAAGACATCCCGGCCGGCCCACCTGAAAGCGAGCGACTGGAAAGTGAACGG
CGCGGGTCATAAAGGTGCGGCAGTGGCGTTCTGGTGGACCATTGGGTGGCCCTGGAATGTGTAG


Restriction Sites SgfI-MluI     
ACCN NM_138322
ORF Size 1464 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_138322.3, NP_612195.1
RefSeq Size 2302
RefSeq ORF 1464
Locus ID 5046
Protein Families Druggable Genome, Protease, Secreted Protein
Gene Summary This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an initial autocatalytic processing event in the ER to generate a heterodimer which exits the ER and sorts to the trans-Golgi network where a second autocatalytic event takes place and the catalytic activity is acquired. The encoded protease is constitutively secreted into the extracellular matrix and expressed in many tissues, including neuroendocrine, liver, gut, and brain. This gene encodes one of the seven basic amino acid-specific members which cleave their substrates at single or paired basic residues. Some of its substrates include transforming growth factor beta related proteins, proalbumin, and von Willebrand factor. This gene is thought to play a role in tumor progression and left-right patterning. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Feb 2014]
Transcript Variant: This variant (3) has multiple differences in the coding region, one of which is a frameshift, compared to variant 1. The encoded isoform PACE4B (also known as PACE4.1) has a distinct C-terminus compared to isoform PACE4-AI. This isoform is thought to be catalytically inactive. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.