PACE4 (PCSK6) (NM_138322) Human Untagged Clone
CAT#: SC309534
PCSK6 (untagged)-Human proprotein convertase subtilisin/kexin type 6 (PCSK6), transcript variant 3
"NM_138322" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PCSK6 |
Synonyms | PACE4; SPC4 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_138322, the custom clone sequence may differ by one or more nucleotides
ATGCCTCCGCGCGCGCCGCCTGCGCCCGGGCCCCGGCCGCCGCCCCGGGCCGCCGCCGCCACCGACACCG CCGCGGGCGCGGGGGGCGCGGGGGGCGCGGGGGGCGCCGGCGGGCCCGGGTTCCGGCCGCTCGCGCCGCG TCCCTGGCGCTGGCTGCTGCTGCTGGCGCTGCCTGCCGCCTGCTCCGCGCCCCCGCCGCGCCCCGTCTAC ACCAACCACTGGGCGGTGCAAGTGCTGGGCGGCCCGGCCGAGGCGGACCGCGTGGCGGCGGCGCACGGGT ACCTCAACTTGGGCCAGATTGGAAACCTGGAAGATTACTACCATTTTTATCACAGCAAAACCTTTAAAAG ATCAACCTTGAGTAGCAGAGGCCCTCACACCTTCCTCAGAATGGACCCCCAGGTGAAATGGCTCCAGCAA CAGGAAGTGAAACGAAGGGTGAAGAGACAGGTGCGAAGTGACCCGCAGGCCCTTTACTTCAACGACCCCA TTTGGTCCAACATGTGGTACCTGCATTGTGGCGACAAGAACAGTCGCTGCCGGTCGGAAATGAATGTCCA GGCAGCGTGGAAGAGGGGCTACACAGGAAAAAACGTGGTGGTCACCATCCTTGATGATGGCATAGAGAGA AATCACCCTGACCTGGCCCCAAATTATGATTCCTACGCCAGCTACGACGTGAACGGCAATGATTATGACC CATCTCCACGATATGATGCCAGCAATGAAAATAAACACGGCACTCGTTGTGCGGGAGAAGTTGCTGCTTC AGCAAACAATTCCTACTGCATCGTGGGCATAGCGTACAATGCCAAAATAGGAGGCATCCGCATGCTGGAC GGCGATGTCACAGATGTGGTCGAGGCAAAGTCGCTGGGCATCAGACCCAACTACATCGACATTTACAGTG CCAGCTGGGGGCCGGACGACGACGGCAAGACGGTGGACGGGCCCGGCCGACTGGCTAAGCAGGCTTTCGA GTATGGCATTAAAAAGGGCCGGCAGGGCCTGGGCTCCATTTTCGTCTGGGCATCTGGGAATGGCGGGAGA GAGGGGGACTACTGCTCGTGCGATGGCTACACCAACAGCATCTACACCATCTCCGTCAGCAGCGCCACCG AGAATGGCTACAAGCCCTGGTACCTGGAAGAGTGTGCCTCCACCCTGGCCACCACCTACAGCAGTGGGGC CTTTTATGAGCGAAAAATCGTCACCACGGATCTGCGTCAGCGCTGTACCGATGGCCACACTGGGACCTCA GTCTCTGCCCCCATGGTGGCGGGCATCATCGCCTTGGCTCTAGAAGCAAACAGCCAGTTAACCTGGAGGG ACGTCCAGCACCTGCTAGTGAAGACATCCCGGCCGGCCCACCTGAAAGCGAGCGACTGGAAAGTGAACGG CGCGGGTCATAAAGGTGCGGCAGTGGCGTTCTGGTGGACCATTGGGTGGCCCTGGAATGTGTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_138322 |
ORF Size | 1464 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_138322.3, NP_612195.1 |
RefSeq Size | 2302 |
RefSeq ORF | 1464 |
Locus ID | 5046 |
Protein Families | Druggable Genome, Protease, Secreted Protein |
Gene Summary | This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an initial autocatalytic processing event in the ER to generate a heterodimer which exits the ER and sorts to the trans-Golgi network where a second autocatalytic event takes place and the catalytic activity is acquired. The encoded protease is constitutively secreted into the extracellular matrix and expressed in many tissues, including neuroendocrine, liver, gut, and brain. This gene encodes one of the seven basic amino acid-specific members which cleave their substrates at single or paired basic residues. Some of its substrates include transforming growth factor beta related proteins, proalbumin, and von Willebrand factor. This gene is thought to play a role in tumor progression and left-right patterning. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Feb 2014] Transcript Variant: This variant (3) has multiple differences in the coding region, one of which is a frameshift, compared to variant 1. The encoded isoform PACE4B (also known as PACE4.1) has a distinct C-terminus compared to isoform PACE4-AI. This isoform is thought to be catalytically inactive. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC217415 | PCSK6 (Myc-DDK-tagged)-Human proprotein convertase subtilisin/kexin type 6 (PCSK6), transcript variant 3 |
USD 450.00 |
|
RG217415 | PCSK6 (GFP-tagged) - Human proprotein convertase subtilisin/kexin type 6 (PCSK6), transcript variant 3 |
USD 500.00 |
|
RC217415L1 | Lenti ORF clone of Human proprotein convertase subtilisin/kexin type 6 (PCSK6), transcript variant 3, Myc-DDK-tagged |
USD 804.00 |
|
RC217415L2 | Lenti ORF clone of Human proprotein convertase subtilisin/kexin type 6 (PCSK6), transcript variant 3, mGFP tagged |
USD 650.00 |
|
RC217415L3 | Lenti ORF clone of Human proprotein convertase subtilisin/kexin type 6 (PCSK6), transcript variant 3, Myc-DDK-tagged |
USD 650.00 |
|
RC217415L4 | Lenti ORF clone of Human proprotein convertase subtilisin/kexin type 6 (PCSK6), transcript variant 3, mGFP tagged |
USD 650.00 |
{0} Product Review(s)
Be the first one to submit a review