RHCE (NM_138616) Human Untagged Clone

CAT#: SC309556

RHCE (untagged)-Human Rh blood group, CcEe antigens (RHCE), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RHCE
• Synonyms: CD240CE; RH; Rh4; RH30A; RHC; RHCe(152N); RHE; RhIVb(J); RHIXB; RHNA; RHPI; RhVI; RhVIII
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_138616, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGCTCTAAGTACCCGCGGTCTGTCCGGCGCTGCCTGCCCCTCTGGGCCCTAACACTGGAAGCAGCTC
  TCATTCTCCTCTTCTATTTTTTTACCCACTATGACGCTTCCTTAGAGGATCAAAAGGGGCTCGTGGCATC
  CTATCAAGTCGGCCAAGATCTGACCGTGATGGCGGCCCTTGGCTTGGGCTTCCTCACCTCAAATTTCCGG
  AGACACAGCTGGAGCAGTGTGGCCTTCAACCTCTTCATGCTGGCGCTTGGTGTGCAGTGGGCAATCCTGC
  TGGACGGCTTCCTGAGCCAGTTCCCTCCTGGGAAGGTGGTCATCACACTGTTCAGTATTCGGCTGGCCAC
  CATGAGTGCTATGTCGGTGCTGATCTCAGCGGGTGCTGTCTTGGGGAAGGTCAACTTGGCGCAGTTGGTG
  GTGATGGTGCTGGTGGAGGTGACAGCTTTAGGCACCCTGAGGATGGTCATCAGTAATATCTTCAACGTGT
  GTTGTAACCGAGTGCTGGGGATTCACCACATCTCCGTCATGCACTCCATCTTCAGCTTGCTGGGTCTGCT
  TGGAGAGATCACCTACATTGTGCTGCTGGTGCTTCATACTGTCTGGAACGGCAATGGCATGATTGGCTTC
  CAGGTCCTCCTCAGCATTGGGGAACTCAGCTTGGCCATCGTGATAGCTCTCACGTCTGGTCTCCTGACAG
  GTTTGCTCCTAAATCTCAAAATATGGAAAGCACCTCATGTGGCTAAATATTTTGATGACCAAGTTTTCTG
  GAAGTTTCCTCATTTGGCTGTTGGATTTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_138616
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_138616.3, NP_619522.3
• RefSeq Size: 1165 bp
• RefSeq ORF: 801 bp
• Locus ID: 6006
• Cytogenetics: 1p36.11
• Protein Families: Transmembrane
• Gene Summary: 'The Rh blood group system is the second most clinically significant of the blood groups, second only to ABO. It is also the most polymorphic of the blood groups, with variations due to deletions, gene conversions, and missense mutations. The Rh blood group includes this gene which encodes both the RhC and RhE antigens on a single polypeptide and a second gene which encodes the RhD protein. The classification of Rh-positive and Rh-negative individuals is determined by the presence or absence of the highly immunogenic RhD protein on the surface of erythrocytes. A mutation in this gene results in amorph-type Rh-null disease. Alternative splicing of this gene results in multiple transcript variants encoding several different isoforms. [provided by RefSeq, Aug 2016]'
  Transcript Variant: This variant (3), also called RhVIII, lacks three internal exons but maintains the reading frame, as compared to variant 1. Isoform 3 lacks 151 internal aa as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.