TAC1 (NM_013997) Human Untagged Clone

CAT#: SC309570

TAC1 (untagged)-Human tachykinin, precursor 1 (TAC1), transcript variant gamma

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TAC1
• Synonyms: Hs.2563; NK2; NKNA; NPK; TAC2
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_013997, the custom clone sequence may differ by one or more nucleotides
  ATGAAAATCCTCGTGGCCTTGGCAGTCTTTTTTCTTGTCTCCACTCAGCTGTTTGCAGAA
  GAAATAGGAGCCAATGATGATCTGAATTACTGGTCCGACTGGTACGACAGCGACCAGATC
  AAGGAGGAACTGCCGGAGCCCTTTGAGCATCTTCTGCAGAGAATCGCCCGGAGACCCAAG
  CCTCAGCAGTTCTTTGGATTAATGGGCAAACGGGATGCTGGACATGGCCAGATCTCTCAC
  AAAAGACATAAAACAGATTCCTTTGTTGGACTAATGGGCAAAAGAGCTTTAAATTCTGTG
  GCTTATGAAAGGAGTGCAATGCAGAATTATGAAAGAAGACGTTAA
  
• Restriction Sites: Please inquire
• ACCN: NM_013997
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_013997.1, NP_054703.1
• RefSeq Size: 1057 bp
• RefSeq ORF: 345 bp
• Locus ID: 6863
• Cytogenetics: 7q21.3
• Protein Families: Druggable Genome, Secreted Protein
• Gene Summary: 'This gene encodes four products of the tachykinin peptide hormone family, substance P and neurokinin A, as well as the related peptides, neuropeptide K and neuropeptide gamma. These hormones are thought to function as neurotransmitters which interact with nerve receptors and smooth muscle cells. They are known to induce behavioral responses and function as vasodilators and secretagogues. Substance P is an antimicrobial peptide with antibacterial and antifungal properties. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2014]'
  Transcript Variant: As compared to the full-length transcript variant beta, variant gamma lacks exon 4, and therefore does not encode neuropeptide K. This transcript does encode substance P, neurokinin A, and is the only variant that encodes neuropeptide gamma.