UCP3 (NM_022803) Human Untagged Clone

CAT#: SC309578

UCP3 (untagged)-Human uncoupling protein 3 (mitochondrial, proton carrier) (UCP3), nuclear gene encoding mitochondrial protein, transcript variant short

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: UCP3
• Synonyms: SLC25A9
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_022803, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGTTGGACTGAAGCCTTCAGACGTGCCTCCCACCATGGCTGTGAAGTTCCTGGGGGCAGGCACAGCAG
  CCTGTTTTGCTGACCTCGTTACCTTTCCACTGGACACAGCCAAGGTCCGCCTGCAGATCCAGGGGGAGAA
  CCAGGCGGTCCAGACGGCCCGGCTCGTGCAGTACCGTGGCGTGCTGGGCACCATCCTGACCATGGTGCGG
  ACTGAGGGTCCCTGCAGCCCCTACAATGGGCTGGTGGCCGGCCTGCAGCGCCAGATGAGCTTCGCCTCCA
  TCCGCATCGGCCTCTATGACTCCGTCAAGCAGGTGTACACCCCCAAAGGCGCGGACAACTCCAGCCTCAC
  TACCCGGATTTTGGCCGGCTGCACCACAGGAGCCATGGCGGTGACCTGTGCCCAGCCCACAGATGTGGTG
  AAGGTCCGATTTCAGGCCAGCATACACCTCGGGCCATCCAGGAGCGACAGAAAATACAGCGGGACTATGG
  ACGCCTACAGAACCATCGCCAGGGAGGAAGGAGTCAGGGGCCTGTGGAAAGGAACTTTGCCCAACATCAT
  GAGGAATGCTATCGTCAACTGTGCTGAGGTGGTGACCTACGACATCCTCAAGGAGAAGCTGCTGGACTAC
  CACCTGCTCACTGACAACTTCCCCTGCCACTTTGTCTCTGCCTTTGGAGCCGGCTTCTGTGCCACAGTGG
  TGGCCTCCCCGGTGGACGTGGTGAAGACCCGGTATATGAACTCACCTCCAGGCCAGTACTTCAGCCCCCT
  CGACTGTATGATAAAGATGGTGGCCCAGGAGGGCCCCACAGCCTTCTACAAGGGGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_022803
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_022803.2, NP_073714.1
• RefSeq Size: 2239 bp
• RefSeq ORF: 828 bp
• Locus ID: 7352
• Cytogenetics: 11q13.4
• Protein Families: Druggable Genome
• Gene Summary: 'Mitochondrial uncoupling proteins (UCP) are members of the larger family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. The different UCPs have tissue-specific expression; this gene is primarily expressed in skeletal muscle. This gene's protein product is postulated to protect mitochondria against lipid-induced oxidative stress. Expression levels of this gene increase when fatty acid supplies to mitochondria exceed their oxidation capacity and the protein enables the export of fatty acids from mitochondria. UCPs contain the three solcar protein domains typically found in MACPs. Two splice variants have been found for this gene.[provided by RefSeq, Nov 2008]'
  Transcript Variant: This variant (short) encodes a protein which is different at the C-terminus from isoform UCP3L. It has an incomplete sixth transmembrane domain and an incomplete purine nucleotide binding domain. Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The extent of this RefSeq transcript is supported by transcript alignments.