Kv3.2 (KCNC2) (NM_139136) Human Untagged Clone
CAT#: SC309605
KCNC2 (untagged)-Human potassium voltage-gated channel, Shaw-related subfamily, member 2 (KCNC2), transcript variant 1
"NM_139136" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | KCNC2 |
Synonyms | KV3.2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_139136, the custom clone sequence may differ by one or more nucleotides
ATGGGCAAGATCGAGAACAACGAGAGGGTGATCCTCAATGTCGGGGGCACCCGGCACGAAACCTACCGCA GCACCCTCAAGACCCTGCCTGGAACACGCCTGGCCCTTCTTGCCTCCTCCGAGCCCCCAGGCGACTGCTT GACCACGGCGGGCGACAAGCTGCAGCCGTCGCCGCCTCCACTGTCGCCGCCGCCGAGAGCGCCCCCGCTG TCCCCCGGGCCAGGCGGCTGCTTCGAGGGCGGCGCGGGCAACTGCAGTTCCCGCGGCGGCAGGGCCAGCG ACCATCCCGGTGGCGGCCGCGAGTTCTTCTTCGACCGGCACCCGGGCGTCTTCGCCTATGTGCTCAATTA CTACCGCACCGGCAAGCTGCACTGCCCCGCAGACGTGTGCGGGCCGCTCTTCGAGGAGGAGCTGGCCTTC TGGGGCATCGACGAGACCGACGTGGAGCCCTGCTGCTGGATGACCTACCGGCAGCACCGCGACGCCGAGG AGGCGCTGGACATCTTCGAGACCCCCGACCTCATTGGCGGCGACCCCGGCGACGACGAGGACCTGGCGGC CAAGAGGCTGGGCATCGAGGACGCGGCGGGGCTCGGGGGCCCCGACGGCAAATCTGGCCGCTGGAGGAGG CTGCAGCCCCGCATGTGGGCCCTCTTCGAAGACCCCTACTCGTCCAGAGCCGCCAGGTTTATTGCTTTTG CTTCTTTATTCTTCATCCTGGTTTCAATTACAACTTTTTGCCTGGAAACACATGAAGCTTTCAATATTGT TAAAAACAAGACAGAACCAGTCATCAATGGCACAAGTGTTGTTCTACAGTATGAAATTGAAACGGATCCT GCCTTGACGTATGTAGAAGGAGTGTGTGTGGTGTGGTTTACTTTTGAATTTTTAGTCCGTATTGTTTTTT CACCCAATAAACTTGAATTCATCAAAAATCTCTTGAATATCATTGACTTTGTGGCCATCCTACCTTTCTA CTTAGAGGTGGGACTCAGTGGGCTGTCATCCAAAGCTGCTAAAGATGTGCTTGGCTTCCTCAGGGTGGTA AGGTTTGTGAGGATCCTGAGAATTTTCAAGCTCACCCGCCATTTTGTAGGTCTGAGGGTGCTTGGACATA CTCTTCGAGCTAGTACTAATGAATTTTTGCTGCTGATAATTTTCCTGGCTCTAGGAGTTTTGATATTTGC TACCATGATCTACTATGCCGAGAGAGTGGGAGCTCAACCTAACGACCCTTCAGCTAGTGAGCACACACAG TTCAAAAACATTCCCATTGGGTTCTGGTGGGCTGTAGTGACCATGACTACCCTGGGTTATGGGGATATGT ACCCCCAAACATGGTCAGGCATGCTGGTGGGAGCCCTGTGTGCTCTGGCTGGAGTGCTGACAATAGCCAT GCCAGTGCCTGTCATTGTCAATAATTTTGGAATGTACTACTCCTTGGCAATGGCAAAGCAGAAACTTCCA AGGAAAAGAAAGAAGCACATCCCTCCTGCTCCTCAGGCAAGCTCACCTACTTTTTGCAAGACAGAATTAA ATATGGCCTGCAATAGTACACAGAGTGACACATGTCTGGGCAAAGACAATCGACTTCTGGAACATAACAG ATCAGTGTTATCAGGTGACGACAGTACAGGAAGTGAGCCGCCACTATCACCCCCAGAAAGGCTCCCCATC AGACGCTCTAGTACCAGAGACAAAAACAGAAGAGGGGAAACATGTTTCCTACTGACGACAGGTGATTACA CGTGTGCTTCTGATGGAGGGATCAGGAAAGATAACTGCAAAGAGGTTGTCATTACTGGTTACACGCAAGC CGAGGCCAGATCTCTTACTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_139136 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_139136.3, NP_631874.1 |
RefSeq Size | 3572 bp |
RefSeq ORF | 1842 bp |
Locus ID | 3747 |
Cytogenetics | 12q21.1 |
Domains | BTB, K_tetra, ion_trans |
Protein Families | Druggable Genome, Ion Channels: Potassium, Transmembrane |
Gene Summary | 'The Shaker gene family of Drosophila encodes components of voltage-gated potassium channels and is comprised of four subfamilies. Based on sequence similarity, this gene is similar to one of these subfamilies, namely the Shaw subfamily. The protein encoded by this gene belongs to the delayed rectifier class of channel proteins and is an integral membrane protein that mediates the voltage-dependent potassium ion permeability of excitable membranes. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]' Transcript Variant: This variant (1) differs in the 3' UTR and coding sequence compared to variant 2. The resulting isoform (KV3.2a) has a shorter and distinct C-terminus compared to isoform KV3.2b. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC220410 | KCNC2 (Myc-DDK-tagged)-Human potassium voltage-gated channel, Shaw-related subfamily, member 2 (KCNC2), transcript variant 1 |
USD 480.00 |
|
RG220410 | KCNC2 (GFP-tagged) - Human potassium voltage-gated channel, Shaw-related subfamily, member 2 (KCNC2), transcript variant 1 |
USD 530.00 |
|
RC220410L3 | Lenti-ORF clone of KCNC2 (Myc-DDK-tagged)-Human potassium voltage-gated channel, Shaw-related subfamily, member 2 (KCNC2), transcript variant 1 |
USD 680.00 |
|
RC220410L4 | Lenti-ORF clone of KCNC2 (mGFP-tagged)-Human potassium voltage-gated channel, Shaw-related subfamily, member 2 (KCNC2), transcript variant 1 |
USD 680.00 |
{0} Product Review(s)
Be the first one to submit a review