ZWINT (NM_032997) Human Untagged Clone
CAT#: SC309620
ZWINT (untagged)-Human ZW10 interactor (ZWINT), transcript variant 2
"NM_032997" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ZWINT |
Synonyms | HZwint-1; KNTC2AP; SIP30; ZWINT1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_032997, the custom clone sequence may differ by one or more nucleotides
ATGGAGGCAGCGGAGACAGAGGCGGAAGCTGCAGCCCTAGAGGTCCTGGCTGAGGTGGCA GGCATCTTGGAACCTGTAGGCCTGCAGGAGGAGGCAGAACTGCCAGCCAAGATCCTGGTT GAGTTTGTGGTGGACTCTCAGAAGAAAGACAAGCTGCTCTGCAGCCAGCTTCAGGTAGCG GATTTCCTGCAGAACATCCTGGCTCAGGAGGACACTGCTAAGGGTCTCGACCCCTTGGCT TCTGAAGACACGAGCCGACAGAAGGCAATTGCAGCTAAGGAACAATGGAAAGAGCTGAAG GCCACCTACAGGGAGCACGTAGAGGCCATCAAAATTGGCCTCACCAAGGCCCTGACTCAG ATGGAGGAAGCCCAGAGGAAACGGACACAACTCCGGGAAGCCTTTGAGCAGCTCCAGGCC AAGAAACAAATGGCCATGGAGAAACGCAGAGCAGTCCAGAACCAGTGGCAGCTACAACAG GAGAAGCATCTGCAGCATCTGGCGGAGGTTTCTGCAGAGGTGAGGGAGCGTAAGACAGGG ACTCAGCAGGAGCTTGACAGGGTGTTTCAGAAACTTGGAAACCTGAAGCAGCAGGCAGAA CAGGAGCGGGACAAGCTGCAGAGGTATCAGACCTTCCTCCAGCTTCTGTATACCCTGCAG GGTAAGCTGTTGTTCCCTGAGGCTGAGGCTGAGGCAGAGAATCTTCCAGATGATAAACCC CAGCAGCCGACTCGACCCCAGGAGCAGAGTACAGGAGACACCATGGGGAGAGACCCTGGT GTGTCCTTCAAGGCTGTTGGTCTACAACCTGCTGGAGATGTAAATTTGCCATGA |
Restriction Sites | Please inquire |
ACCN | NM_032997 |
ORF Size | 834 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_032997.2, NP_127490.1 |
RefSeq Size | 1878 |
RefSeq ORF | 834 |
Locus ID | 11130 |
Protein Families | Druggable Genome |
Gene Summary | This gene encodes a protein that is clearly involved in kinetochore function although an exact role is not known. It interacts with ZW10, another kinetochore protein, possibly regulating the association between ZW10 and kinetochores. The encoded protein localizes to prophase kinetochores before ZW10 does and it remains detectable on the kinetochore until late anaphase. It has a uniform distribution in the cytoplasm of interphase cells. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) differs in the 3' UTR compared to variant 1. Variants 1 and 2 both encode isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218480 | ZWINT (Myc-DDK-tagged)-Human ZW10 interactor (ZWINT), transcript variant 2 |
USD 420.00 |
|
RG218480 | ZWINT (GFP-tagged) - Human ZW10 interactor (ZWINT), transcript variant 2 |
USD 460.00 |
|
RC218480L3 | Lenti ORF clone of Human ZW10 interactor (ZWINT), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC218480L4 | Lenti ORF clone of Human ZW10 interactor (ZWINT), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review