ZWINT (NM_032997) Human Untagged Clone

CAT#: SC309620

ZWINT (untagged)-Human ZW10 interactor (ZWINT), transcript variant 2


  "NM_032997" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "ZWINT"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ZWINT
Synonyms HZwint-1; KNTC2AP; SIP30; ZWINT1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_032997, the custom clone sequence may differ by one or more nucleotides
ATGGAGGCAGCGGAGACAGAGGCGGAAGCTGCAGCCCTAGAGGTCCTGGCTGAGGTGGCA
GGCATCTTGGAACCTGTAGGCCTGCAGGAGGAGGCAGAACTGCCAGCCAAGATCCTGGTT
GAGTTTGTGGTGGACTCTCAGAAGAAAGACAAGCTGCTCTGCAGCCAGCTTCAGGTAGCG
GATTTCCTGCAGAACATCCTGGCTCAGGAGGACACTGCTAAGGGTCTCGACCCCTTGGCT
TCTGAAGACACGAGCCGACAGAAGGCAATTGCAGCTAAGGAACAATGGAAAGAGCTGAAG
GCCACCTACAGGGAGCACGTAGAGGCCATCAAAATTGGCCTCACCAAGGCCCTGACTCAG
ATGGAGGAAGCCCAGAGGAAACGGACACAACTCCGGGAAGCCTTTGAGCAGCTCCAGGCC
AAGAAACAAATGGCCATGGAGAAACGCAGAGCAGTCCAGAACCAGTGGCAGCTACAACAG
GAGAAGCATCTGCAGCATCTGGCGGAGGTTTCTGCAGAGGTGAGGGAGCGTAAGACAGGG
ACTCAGCAGGAGCTTGACAGGGTGTTTCAGAAACTTGGAAACCTGAAGCAGCAGGCAGAA
CAGGAGCGGGACAAGCTGCAGAGGTATCAGACCTTCCTCCAGCTTCTGTATACCCTGCAG
GGTAAGCTGTTGTTCCCTGAGGCTGAGGCTGAGGCAGAGAATCTTCCAGATGATAAACCC
CAGCAGCCGACTCGACCCCAGGAGCAGAGTACAGGAGACACCATGGGGAGAGACCCTGGT
GTGTCCTTCAAGGCTGTTGGTCTACAACCTGCTGGAGATGTAAATTTGCCATGA
Restriction Sites Please inquire     
ACCN NM_032997
ORF Size 834 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_032997.2, NP_127490.1
RefSeq Size 1878
RefSeq ORF 834
Locus ID 11130
Protein Families Druggable Genome
Gene Summary This gene encodes a protein that is clearly involved in kinetochore function although an exact role is not known. It interacts with ZW10, another kinetochore protein, possibly regulating the association between ZW10 and kinetochores. The encoded protein localizes to prophase kinetochores before ZW10 does and it remains detectable on the kinetochore until late anaphase. It has a uniform distribution in the cytoplasm of interphase cells. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) differs in the 3' UTR compared to variant 1. Variants 1 and 2 both encode isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.