CMTM7 (NM_181472) Human Untagged Clone

CAT#: SC309697

CMTM7 (untagged)-Human CKLF-like MARVEL transmembrane domain containing 7 (CMTM7), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CMTM7
• Synonyms: CKLFSF7
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_181472, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCGCACGGAGCCGGGCTCGTCCGCACCACGTGCAGCAGCGGCAGCGCGCTCGGACCCGGGGCCGGCG
  CGGCCCAGCCCAGCGCGAGCCCCTTGGAGGGGCTGCTGGACCTCAGCTACCCCCGCACCCACGCGGCCCT
  GCTGAAAGTGGCGCAAATGGTCACCCTGCTGATTGCCTTCATCTGTGTGCGGAGCTCCCTGTGGACCAAC
  TACAGCGCCTACAGCTACTTTGAAGTGGTCACCATTTGCGACTTGATAATGATCCTCGCCTTTTACCTGG
  TCCACCTCTTCCGCTTCTACCGCGTGCTCACCTGTATCAGCTGGCCCCTGTCGATCTTTGGTTTCATGGC
  CACCTTCCTCTGCATGGCAAGCATATGGCTGTCCTATAAGATCTCGTGTGTAACCCAGTCCACAGATGCA
  GCCGTCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_181472
• ORF Size: 429 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_181472.2, NP_852137.1
• RefSeq Size: 1939
• RefSeq ORF: 429
• Locus ID: 112616
• Protein Families: Transmembrane
• Gene Summary: This gene belongs to the chemokine-like factor gene superfamily, a novel family that is similar to the chemokine and transmembrane 4 superfamilies. This gene is one of several chemokine-like factor genes located in a cluster on chromosome 3. This gene acts as a tumor suppressor that regulates G1/S transition in the cell cycle, and epidermal growth factor receptor/protein kinase B signaling during tumor pathogenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2016]
  Transcript Variant: This variant (2) lacks an in-frame exon in the 3' coding region, compared to variant 1. The encoded isoform (b) is shorter than isoform a.