PTGER3 (NM_198717) Human Untagged Clone
CAT#: SC309719
PTGER3 (untagged)-Human prostaglandin E receptor 3 (subtype EP3) (PTGER3), transcript variant 7
"NM_198717" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PTGER3 |
Synonyms | EP3; EP3-I; EP3-II; EP3-III; EP3-IV; EP3-VI; EP3e; PGE2-R |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_198717 edited
AGGAAGGCGTGGCTCCCTCCCGGGCCAGTGAGCCCTGGCGCCGCCGCGGCCGCGGTCCCA GCAGCGGAGTAGGGCGGCGGCTGCGCCCCGCACCATGGGGGGCAGCCCAGCCCCAGCCGC GGTAAACGCCGACCTCCGCCGCCGCCCGCGCCGCGTCTGCCCCCTCCCGCTGCGGCTCTC TGGACGCCATCCCCTCCTCACCTCGAAGCCAACATGAAGGAGACCCGGGGCTACGGAGGG GATGCCCCCTTCTGCACCCGCCTCAACCACTCCTACACAGGCATGTGGGCGCCCGAGCGT TCCGCCGAGGCGCGGGGCAACCTCACGCGCCCTCCAGGGTCTGGCGAGGATTGCGGATCG GTGTCCGTGGCCTTCCCGATCACCATGCTGCTCACTGGTTTCGTGGGCAACGCACTGGCC ATGCTGCTCGTGTCGCGCAGCTACCGGCGCCGGGAGAGCAAGCGCAAGAAGTCCTTCCTG CTGTGCATCGGCTGGCTGGCGCTCACCGACCTGGTCGGGCAGCTTCTCACCACCCCGGTC GTCATCGTCGTGTACCTGTCCAAGCAGCGTTGGGAGCACATCGACCCGTCGGGGCGGCTC TGCACCTTTTTCGGGCTGACCATGACTGTTTTCGGGCTCTCCTCGTTGTTCATCGCCAGC GCCATGGCCGTCGAGCGGGCGCTGGCCATCAGGGCGCCGCACTGGTATGCGAGCCACATG AAGACGCGTGCCACCCGCGCTGTGCTGCTCGGCGTGTGGCTGGCCGTGCTCGCCTTCGCC CTGCTGCCGGTGCTGGGCGTGGGCCAGTACACCGTCCAGTGGCCCGGGACGTGGTGCTTC ATCAGCACCGGGCGAGGGGGCAACGGGACTAGCTCTTCGCATAACTGGGGCAACCTTTTC TTCGCCTCTGCCTTTGCCTTCCTGGGGCTCTTGGCGCTGACAGTCACCTTTTCCTGCAAC CTGGCCACCATTAAGGCCCTGGTGTCCCGCTGCCGGGCCAAGGCCACGGCATCTCAGTCC AGTGCCCAGTGGGGCCGCATCACGACCGAGACGGCCATTCAGCTTATGGGGATCATGTGC GTGCTGTCGGTCTGCTGGTCTCCGCTCCTGATAATGATGTTGAAAATGATCTTCAATCAG ACATCAGTTGAGCACTGCAAGACACACACGGAGAAGCAGAAAGAATGCAACTTCTTCTTA ATAGCTGTTCGCCTGGCTTCACTGAACCAGATCTTGGATCCTTGGGTTTACCTGCTGTTA AGAAAGATCCTTCTTCGAAAGTTTTGCCAGGAGGAATTTTGGGGAAATTAAAACCTGCCT TTCTGCCAGGATCACATCACTGGAAGCTCCATGACTCTCTTTTTGTAAAAGAAAAAAAAA TCACAGAAACACCCACCTCCCAAACTATTCTCTTTTACTTCTTCCCCCAAGCCCACCCCC AAATATAACTGTTATCCAGAAGCTGTTATGTCCTGTTTCCATACATGTTTTTGTACTTTT ACTATATCTACATACATCAATTAAACTTATGTCCTATTGTTTTGTGAATTTAAAAAAAAA AAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_198717 |
Insert Size | 1600 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_198717.1, NP_942010.1 |
RefSeq Size | 1817 bp |
RefSeq ORF | 1098 bp |
Locus ID | 5733 |
Cytogenetics | 1p31.1 |
Protein Families | Druggable Genome, GPCR, Transcription Factors, Transmembrane |
Protein Pathways | Calcium signaling pathway, Neuroactive ligand-receptor interaction |
Gene Summary | 'The protein encoded by this gene is a member of the G-protein coupled receptor family. This protein is one of four receptors identified for prostaglandin E2 (PGE2). This receptor may have many biological functions, which involve digestion, nervous system, kidney reabsorption, and uterine contraction activities. Studies of the mouse counterpart suggest that this receptor may also mediate adrenocorticotropic hormone response as well as fever generation in response to exogenous and endogenous stimuli. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]' Transcript Variant: This variant (7) lacks multiple exons compared to variant 1. The resulting protein (isoform 7) has a distinct and shorter C-terminus as compared to isoform 1. Other names for this transcript are EP3b and EP3E. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222935 | PTGER3 (Myc-DDK-tagged)-Human prostaglandin E receptor 3 (subtype EP3) (PTGER3), transcript variant 7 |
USD 420.00 |
|
RG222935 | PTGER3 (GFP-tagged) - Human prostaglandin E receptor 3 (subtype EP3) (PTGER3), transcript variant 7 |
USD 460.00 |
|
RC222935L3 | Lenti-ORF clone of PTGER3 (Myc-DDK-tagged)-Human prostaglandin E receptor 3 (subtype EP3) (PTGER3), transcript variant 7 |
USD 620.00 |
|
RC222935L4 | Lenti-ORF clone of PTGER3 (mGFP-tagged)-Human prostaglandin E receptor 3 (subtype EP3) (PTGER3), transcript variant 7 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review