TAP2 (NM_018833) Human Untagged Clone

CAT#: SC310195

TAP2 (untagged)-Human transporter 2, ATP-binding cassette, sub-family B (MDR/TAP) (TAP2), transcript variant 2


  "NM_018833" in other vectors (4)

Reconstitution Protocol

USD 1,100.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "TAP2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TAP2
Synonyms ABC18; ABCB3; APT2; D6S217E; PSF-2; PSF2; RING11
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_018833, the custom clone sequence may differ by one or more nucleotides


ATGCGGCTCCCTGACCTGAGACCCTGGACCTCCCTGCTGCTGGTGGACGCGGCTTTACTGTGGCTGCTTC
AGGGCCCTCTGGGGACTTTGCTTCCTCAAGGGCTGCCAGGACTATGGCTGGAGGGGACCCTGCGGCTGGG
AGGGCTGTGGGGGCTGCTAAAGCTAAGAGGGCTGCTGGGATTTGTGGGGACACTGCTGCTCCCGCTCTGT
CTGGCCACCCCCCTGACTGTCTCCCTGAGAGCCCTGGTCGCGGGGGCCTCACGTGCTCCCCCAGCCAGAG
TCGCTTCAGCCCCTTGGAGCTGGCTGCTGGTGGGGTACGGGGCTGCGGGGCTCAGCTGGTCACTGTGGGC
TGTTCTGAGCCCTCCTGGAGCCCAGGAGAAGGAGCAGGACCAGGTGAACAACAAAGTCTTGATGTGGAGG
CTGCTGAAGCTCTCCAGGCCGGACCTGCCTCTCCTCGTTGCCGCCTTCTTCTTCCTTGTCCTTGCTGTTT
TGGGTGAGACATTAATCCCTCACTATTCTGGTCGTGTGATTGACATCCTGGGAGGTGATTTTGACCCCCA
TGCCTTTGCCAGTGCCATCTTCTTCATGTGCCTCTTCTCCTTTGGCAGCTCACTGTCTGCAGGCTGCCGA
GGAGGCTGCTTCACCTACACCATGTCTCGAATCAACTTGCGGATCCGGGAGCAGCTTTTCTCCTCCCTGC
TGCGCCAGGACCTCGGTTTCTTCCAGGAGACTAAGACAGGGGAGCTGAACTCACGGCTGAGCTCGGATAC
CACCCTGATGAGTAACTGGCTTCCTTTAAATGCCAATGTGCTCTTGCGAAGCCTGGTGAAAGTGGTGGGG
CTGTATGGCTTCATGCTCAGCATATCGCCTCGACTCACCCTCCTTTCTCTGCTGCACATGCCCTTCACAA
TAGCAGCGGAGAAGGTGTACAACACCCGCCATCAGGAAGTGCTTCGGGAGATCCAGGATGCAGTGGCCAG
GGCGGGGCAGGTGGTGCGGGAAGCCGTTGGAGGGCTGCAGACCGTTCGCAGTTTTGGGGCCGAGGAGCAT
GAAGTCTGTCGCTATAAAGAGGCCCTTGAACAATGTCGGCAGCTGTATTGGCGGAGAGACCTGGAACGCG
CCTTGTACCTGCTCGTAAGGAGGGTGCTGCACTTGGGGGTGCAGATGCTGATGCTGAGCTGTGGGCTGCA
GCAGATGCAGGATGGGGAGCTCACCCAGGGCAGCCTGCTTTCCTTTATGATCTACCAGGAGAGCGTGGGG
AGCTATGTGCAGACCCTGGTATACATATATGGGGATATGCTCAGCAACGTGGGAGCTGCAGAGAAGGTTT
TCTCCTACATGGACCGACAGCCAAATCTGCCTTCACCTGGCACGCTTGCCCCCACCACTCTGCAGGGGGT
TGTGAAATTCCAAGACGTCTCCTTTGCATATCCCAATCGCCCTGACAGGCCTGTGCTCAAGGGGCTGACG
TTTACCCTACGTCCTGGTGAGGTGACGGCGCTGGTGGGACCCAATGGGTCTGGGAAGAGCACAGTGGCTG
CCCTGCTGCAGAATCTGTACCAGCCCACAGGGGGACAGGTGCTGCTGGATGAAAAGCCCATCTCACAGTA
TGAACACTGCTACCTGCACAGCCAGGTGGTTTCAGTTGGGCAGGAGCCTGTGCTGTTCTCCGGTTCTGTG
AGGAACAACATTGCTTATGGGCTGCAGAGCTGCGAAGATGATAAGGTGATGGCGGCTGCCCAGGCTGCCC
ACGCAGATGACTTCATCCAGGAAATGGAGCATGGAATATACACAGATGTAGGGGAGAAGGGAAGCCAGCT
GGCTGCGGGACAGAAACAACGTCTGGCCATTGCCCGGGCCCTTGTACGAGACCCGCGGGTCCTCATCCTG
GATGAGGCTACTAGTGCCCTAGATGTGCAGTGCGAGCAGGCCAAAACCCTTTGGAAGTTCATGATATTTT
GA


Restriction Sites SgfI-MluI     
ACCN NM_018833
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_018833.2, NP_061313.2
RefSeq Size 2540 bp
RefSeq ORF 1962 bp
Locus ID 6891
Cytogenetics 6p21.32
Domains ABC_membrane, ABC_tran, AAA
Protein Families Druggable Genome, Transmembrane
Protein Pathways ABC transporters, Antigen processing and presentation, Primary immunodeficiency
Gene Summary 'The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. This gene is located 7 kb telomeric to gene family member ABCB2. The protein encoded by this gene is involved in antigen presentation. This protein forms a heterodimer with ABCB2 in order to transport peptides from the cytoplasm to the endoplasmic reticulum. Mutations in this gene may be associated with ankylosing spondylitis, insulin-dependent diabetes mellitus, and celiac disease. Alternative splicing of this gene produces products which differ in peptide selectivity and level of restoration of surface expression of MHC class I molecules. [provided by RefSeq, Feb 2014]'
Transcript Variant: This variant (2) differs in the 5' UTR and coding region compared to variant 1. The resulting isoform (2) is shorter and has a distinct C-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.