KCNN2 (NM_021614) Human Untagged Clone

CAT#: SC310251

KCNN2 (untagged)-Human potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2 (KCNN2), transcript variant 1


  "NM_021614" in other vectors (6)

Reconstitution Protocol

SC310251 is the updated version of SC112899.

USD 760.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "KCNN2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol KCNN2
Synonyms hSK2; KCa2.2; SK2; SKCA2; SKCa 2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_021614, the custom clone sequence may differ by one or more nucleotides


ATGAGCAGCTGCAGGTACAACGGGGGCGTCATGCGGCCGCTCAGCAACTTGAGCGCGTCCCGCCGGAACC
TGCACGAGATGGACTCAGAGGCGCAGCCCCTGCAGCCCCCCGCGTCTGTCGGAGGAGGTGGCGGCGCGTC
CTCCCCGTCTGCAGCCGCTGCCGCCGCCGCCGCTGTTTCGTCCTCAGCCCCCGAGATCGTGGTGTCTAAG
CCCGAGCACAACAACTCCAACAACCTGGCGCTCTATGGAACCGGCGGCGGAGGCAGCACTGGAGGAGGCG
GCGGCGGTGGCGGGAGCGGGCACGGCAGCAGCAGTGGCACCAAGTCCAGCAAAAAGAAAAACCAGAACAT
CGGCTACAAGCTGGGCCACCGGCGCGCCCTGTTCGAAAAGCGCAAGCGGCTCAGCGACTACGCGCTCATC
TTCGGCATGTTCGGCATCGTGGTCATGGTCATCGAGACCGAGCTGTCGTGGGGCGCCTACGACAAGGCGT
CGCTGTATTCCTTAGCTCTGAAATGCCTTATCAGTCTCTCCACGATCATCCTGCTCGGTCTGATCATCGT
GTACCACGCCAGGGAAATACAGTTGTTCATGGTGGACAATGGAGCAGATGACTGGAGAATAGCCATGACT
TATGAGCGTATTTTCTTCATCTGCTTGGAAATACTGGTGTGTGCTATTCATCCCATACCTGGGAATTATA
CATTCACATGGACGGCCCGGCTTGCCTTCTCCTATGCCCCATCCACAACCACCGCTGATGTGGATATTAT
TTTATCTATACCAATGTTCTTAAGACTCTATCTGATTGCCAGAGTCATGCTTTTACATAGCAAACTTTTC
ACTGATGCCTCCTCTAGAAGCATTGGAGCACTTAATAAGATAAACTTCAATACACGTTTTGTTATGAAGA
CTTTAATGACTATATGCCCAGGAACTGTACTCTTGGTTTTTAGTATCTCATTATGGATAATTGCCGCATG
GACTGTCCGAGCTTGTGAAAGGTACCATGATCAACAGGATGTTACTAGCAACTTCCTTGGAGCGATGTGG
TTGATATCAATAACTTTTCTCTCCATTGGTTATGGTGACATGGTACCTAACACATACTGTGGAAAAGGAG
TCTGCTTACTTACTGGAATTATGGGTGCTGGTTGCACAGCCCTGGTGGTAGCTGTAGTGGCAAGGAAGCT
AGAACTTACCAAAGCAGAAAAACACGTGCACAATTTCATGATGGATACTCAGCTGACTAAAAGAGTAAAA
AATGCAGCTGCCAATGTACTCAGGGAAACATGGCTAATTTACAAAAATACAAAGCTAGTGAAAAAGATAG
ATCATGCAAAAGTAAGAAAACATCAACGAAAATTCCTGCAAGCTATTCATCAATTAAGAAGTGTAAAAAT
GGAGCAGAGGAAACTGAATGACCAAGCAAACACTTTGGTGGACTTGGCAAAGACCCAGAACATCATGTAT
GATATGATTTCTGACTTAAACGAAAGGAGTGAAGACTTCGAGAAGAGGATTGTTACCCTGGAAACAAAAC
TAGAGACTTTGATTGGTAGCATCCACGCCCTCCCTGGGCTCATAAGCCAGACCATCAGGCAGCAGCAGAG
AGATTTCATTGAGGCTCAGATGGAGAGCTACGACAAGCACGTCACTTACAATGCTGAGCGGTCCCGGTCC
TCGTCCAGGAGGCGGCGGTCCTCTTCCACAGCACCACCAACTTCATCAGAGAGTAGCTAG


Restriction Sites SgfI-MluI     
ACCN NM_021614
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_021614.3, NP_067627.2
RefSeq Size 2531 bp
RefSeq ORF 1740 bp
Locus ID 3781
Cytogenetics 5q22.3
Domains SK_channel, CaMBD
Protein Families Druggable Genome, Ion Channels: Potassium, Transmembrane
Gene Summary 'Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. The protein encoded by this gene is activated before membrane hyperpolarization and is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. This gene is a member of the KCNN family of potassium channel genes. The encoded protein is an integral membrane protein that forms a voltage-independent calcium-activated channel with three other calmodulin-binding subunits. Alternate splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]'
Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (a).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.