KCNC1 (NM_004976) Human Untagged Clone

CAT#: SC310304

KCNC1 (untagged)-Human potassium voltage-gated channel, Shaw-related subfamily, member 1 (KCNC1), transcript variant B


  "NM_004976" in other vectors (6)

Reconstitution Protocol

SC310304 is the updated version of SC124010.

USD 870.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "KCNC1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol KCNC1
Synonyms EPM7; KV3.1; KV4; NGK2
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_004976 edited
GCCCTTACCCATGGGAGCGGCCGCCAGGGGGAGTTGGCGCCGGGGAGGGGGCCGCGCCAT
GCCTAAGGGGGCGCCGCGATGGGCCAAGGGGACGAGAGCGAGCGCATCGTGATCAACGTG
GGCGGCACGCGCCACCAGACGCACCGCTCGACCCTGCGCACGCTGCCCGGCACGCGGCTC
GCCTGGCTGGCGGAGCCCGACGCCCACAGCCACTTCGACTATGACCCGCGTGCTGACGAG
TTCTTCTTCGACCGCCACCCCGGCGTCTTCGCGCACATCCTGAACTACTACCGCACGGGC
AAGCTGCACTG:CCCAGCCGACGTGTGCGGGCCGCTCTACGAGGAGGAGCTGGCCTTCTG
GGGCATCGACGAGACCGACGTGGAGCCCTGCTGCTGGATGACGTACCGCCAGCACCGCGA
CGCCGAGGAGGCTCTGGACAGCTTCGGCGGCGCTCCTCTGGACAACAGCGCCGACGACGC
GGACGCCGACGGCCCTGGCGACTCGGGCGACGGCGAGGACGAGCTGGAGATGACCAAGCG
CCTGGCGCTCAGTGACTCCCCGGATGGCCGGCCTGGCGGCTTTTGGCGCCGCTGGCAGCC
GCGCATCTGGGCGCTCTTCGAGGACCCGTACTCGTCCCGCTACGCGCGGTATGTGGCCTT
CGCTTCCCTCTTCTTCATCCTGGTCTCCATCACCACCTTCTGCCTGGAGACCCACGAGCG
CTTCAACCCCATCGTGAACAAGACGGAGATCGAGAACGTTCGCAATGGCACGCAAGTGCG
CTACTACCGGGAGGCCGAGACGGAGGCCTTCCTTACCTACATCGAGGGCGTCTGTGTGGT
CTGGTTCACCTTCGAGTTCCTCATGCGTGTCATCTTCTGCCCCAACAAGGTAGAGTTCAT
CAAGAACTCGCTCAACATCATTGACTTTGTGGCCATCCTGCCCTTCTACCTGGAGGTGGG
GCTGAGCGGCCTGTCCTCCAAGGCAGCCAAGGACGTGCTGGGCTTCCTGCGCGTCGTCCG
CTTCGTGCGCATCTTGCGCATCTTTAAGCTGACCCGCCACTTTGTGGGCCTGCGGGTCCT
GGGCCACACGCTCCGAGCCAGCACCAACGAGTTCCTGCTGCTCATCATCTTCCTGGCCTT
GGGCGTGCTGATCTTCGCCACCATGATCTACTACGCCGAGAGGATAGGGGCACAGCCCAA
TGACCCCAGCGCCAGTGAGCACACGCACTTTAAGAACATCCCCATCGGCTTCTGGTGGGC
CGTGGTCACCATGACGACCCTGGGCTATGGAGACATGTACCCGCAGACGTGGTCCGGCAT
GCTGGTGGGGGCTCTGTGTGCGCTGGCGGGCGTGCTCACCATCGCCATGCCCGTGCCCGT
CATCGTGAACAATTTCGGGATGTATTACTCCTTAGCCATGGCTAAGCAGAAACTACCAAA
GAAAAAAAAGAAGCATATTCCGCGGCCACCGCAGCTGGGATCTCCCAATTATTGTAAATC
TGTCGTAAACTCTCCACACCACAGTACTCAGAGTGACACATGTCCGCTGGCCCAGGAAGA
AATTTTAGAAATTAACAGAGCAGGTAGGAAACCTCTTAGAGGCATGTCGATCTGA
Restriction Sites Please inquire     
ACCN NM_004976
Insert Size 1600 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The ORF of this clone has been fully sequenced and found to contain one SNP compared with NM_004976.2.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_004976.2, NP_004967.1
RefSeq Size 1602 bp
RefSeq ORF 1536 bp
Locus ID 3746
Cytogenetics 11p15.1
Protein Families Druggable Genome, Ion Channels: Potassium, Transmembrane
Gene Summary 'This gene encodes a member of a family of integral membrane proteins that mediate the voltage-dependent potassium ion permeability of excitable membranes. Alternative splicing is thought to result in two transcript variants encoding isoforms that differ at their C-termini. These isoforms have had conflicting names in the literature: the longer isoform has been called both "b" and "alpha", while the shorter isoform has been called both "a" and "beta" (PMIDs 1432046, 12091563). [provided by RefSeq, Oct 2014]'
Transcript Variant: This variant (2) lacks two exons and its 3' exon extends past a splice site used in variant 1, resulting in a distinct 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (2) has a shorter and distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.