NEK3 (NM_152720) Human Untagged Clone
CAT#: SC310308
NEK3 (untagged)-Human NIMA (never in mitosis gene a)-related kinase 3 (NEK3), transcript variant 2
"NM_152720" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | NEK3 |
Synonyms | HSPK36 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_152720, the custom clone sequence may differ by one or more nucleotides
ATGGATGACTACATGGTCCTGAGAATGATTGGGGAGGGCTCCTTCGGCAGAGCTCTTTTGGTTCAGCATG AAAGCAGTAATCAGATGTTTGCCATGAAAGAAATAAGGCTTCCCAAGTCTTTCTCTAATACACAGAATTC TAGGAAGGAGGCTGTTCTTTTAGCCAAAATGAAACACCCTAATATTGTTGCCTTCAAAGAATCATTTGAA GCTGAAGGACACTTGTATATTGTGATGGAATACTGTGATGGAGGGGATCTAATGCAAAAGATTAAACAGC AGAAAGGAAAGTTATTTCCTGAAGACATGATACTTAATTGGTTTACCCAAATGTGCCTTGGAGTAAATCA CATTCACAAGAAACGTGTGCTACACAGAGATATCAAGTCCAAGAATATCTTCCTCACTCAGAATGGAAAA GTGAAATTGGGAGACTTTGGATCTGCCCGTCTTCTCTCCAATCCGATGGCATTTGCTTGTACCTATGTGG GAACTCCTTATTATGTGCCTCCAGAAATTTGGGAAAACCTGCCTTATAACAATAAAAGTGACATCTGGTC CTTGGGTTGCATCCTGTATGAACTCTGTACCCTTAAGCATCCATTTCAGGCAAATAGTTGGAAAAATCTT ATCCTCAAAGTATGTCAAGGGTGCATCAGTCCACTGCCGTCTCATTACTCCTATGAACTTCAGTTCCTAG TCAAGCAGATGTTTAAAAGGAATCCCTCACATCGCCCCTCGGCTACAACGCTTCTCTCTCGAGGCATCGT AGCTCGGCTTGTCCAGAAGTGCTTACCCCCCGAGATCATCATGGAATATGGTGAGGAAGTATTAGAAGAA ATAAAAAATTCGAAGCATAACACACCAAGAAAAAAAACAAACCCCAGCAGAATCAGGATAGCTTTGGGAA ATGAAGCAAGCACAGTGCAAGAGGAAGAACAAGATAGAAAGGGTAGCCATACTGATTTGGAAAGCATTAA TGAAAATTTAGTTGAAAGTGCATTGAGAAGAGTAAACAGAGAAGAAAAAGGTAATAAGTCAGTCCATCTG AGGAAAGCCAGTTCACCAAATCTTCATAGACGACAGTGGGAGAAAAATGTACCCAATACAGCTCTTACAG CTTTGGAAAATGCATCCATACTCACCTCCAGTTTAACAGCAGAGGACGATAGAGGTGGTTCTGTAATAAA GTACAGCAAAAATACTACTCGTAAGCAGTGGCTCAAAGAGACCCCTGACACTTTGTTGAACATCCTTAAG AATGCTGATCTCAGCTTGGCTTTTCAAACATACACAATATATAGACCAGGTTCAGAAGGGTTCTTGAAAG GCCCCCTGTCTGAAGAAACAGAAGCATCGGACAGTGTTGATGGAGGTCACGATTCTGTCATTTTGGATCC AGAGCGACTTGAGCCTGGGCTAGATGAGGAGGACACGGACTTTGAGGAGGAAGATGACAACCCCGACTGG GTGTCAGAGCTGAAGAAGCGAGCTGGATGGCAAGGCCTGTGCGACAGATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_152720 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_152720.2, NP_689933.1 |
RefSeq Size | 2424 bp |
RefSeq ORF | 1521 bp |
Locus ID | 4752 |
Cytogenetics | 13q14.3 |
Domains | pkinase, TyrKc, S_TKc |
Protein Families | Druggable Genome, Protein Kinase |
Gene Summary | 'This gene encodes a member of the NimA (never in mitosis A) family of serine/threonine protein kinases. The encoded protein differs from other NimA family members in that it is not cell cycle regulated and is found primarily in the cytoplasm. The kinase is activated by prolactin stimulation, leading to phosphorylation of VAV2 guanine nucleotide exchange factor, paxillin, and activation of the RAC1 GTPase. Two functional alleles for this gene have been identified in humans. The reference genome assembly (GRCh38) represents a functional allele that is associated with the inclusion of an additional coding exon in protein-coding transcripts, compared to an alternate functional allele that lacks the exon. [provided by RefSeq, Sep 2019]' Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC205775 | NEK3 (Myc-DDK-tagged)-Human NIMA (never in mitosis gene a)-related kinase 3 (NEK3), transcript variant 2 |
USD 420.00 |
|
RG205775 | NEK3 (GFP-tagged) - Human NIMA (never in mitosis gene a)-related kinase 3 (NEK3), transcript variant 2 |
USD 460.00 |
|
RC205775L1 | Lenti ORF clone of Human NIMA (never in mitosis gene a)-related kinase 3 (NEK3), transcript variant 2, Myc-DDK-tagged |
USD 768.00 |
|
RC205775L2 | Lenti ORF clone of Human NIMA (never in mitosis gene a)-related kinase 3 (NEK3), transcript variant 2, mGFP tagged |
USD 620.00 |
|
RC205775L3 | Lenti ORF clone of Human NIMA (never in mitosis gene a)-related kinase 3 (NEK3), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC205775L4 | Lenti ORF clone of Human NIMA (never in mitosis gene a)-related kinase 3 (NEK3), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review