MEIS2 (NM_170675) Human Untagged Clone

CAT#: SC310346

MEIS2 (untagged)-Human Meis homeobox 2 (MEIS2), transcript variant c


  "NM_170675" in other vectors (6)

Reconstitution Protocol

SC310346 is the updated version of SC109423.

USD 810.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "MEIS2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MEIS2
Synonyms CPCMR; HsT18361; MRG1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_170675, the custom clone sequence may differ by one or more nucleotides


ATGGCGCAAAGGTACGATGAGCTGCCCCATTACGGCGGGATGGACGGAGTAGGGGTTCCCGCTTCCATGT
ACGGAGACCCTCACGCGCCGCGGCCGATCCCCCCGGTTCACCACCTGAACCACGGGCCGCCGCTCCACGC
CACACAGCACTACGGCGCGCACGCCCCGCACCCCAATGTCATGCCGGCCAGTATGGGATCCGCTGTCAAC
GACGCCTTGAAGCGGGACAAGGACGCGATCTATGGGCACCCGTTGTTTCCTCTGTTAGCTCTGGTCTTTG
AGAAGTGCGAGCTGGCGACCTGCACTCCCCGGGAACCTGGAGTGGCTGGCGGAGACGTCTGCTCCTCCGA
CTCCTTCAACGAGGACATCGCGGTCTTCGCCAAGCAGGTTCGCGCCGAAAAGCCACTTTTTTCCTCAAAT
CCAGAGCTGGACAATTTGATGATACAAGCAATACAAGTACTAAGGTTTCATCTTTTGGAGTTAGAAAAGG
TCCACGAACTGTGCGATAACTTCTGCCACCGATACATTAGCTGTTTGAAGGGGAAAATGCCCATCGACCT
CGTCATTGATGAAAGAGACGGCAGCTCCAAGTCAGATCATGAAGAACTTTCAGGCTCCTCCACAAATCTC
GCTGACCATAACCCTTCTTCTTGGCGAGACCACGATGATGCAACCTCAACCCACTCAGCAGGCACCCCAG
GGCCCTCCAGTGGGGGCCATGCTTCCCAGAGCGGAGACAACAGCAGTGAGCAAGGGGATGGTTTAGACAA
CAGTGTAGCTTCACCTGGTACAGGTGACGATGATGATCCGGATAAGGACAAAAAACGCCAGAAGAAAAGA
GGCATTTTCCCCAAAGTAGCAACAAATATCATGAGAGCATGGCTCTTCCAGCATCTCACACATCCGTACC
CTTCCGAAGAGCAGAAGAAACAGTTAGCGCAAGACACAGGACTTACAATTCTCCAAGTAAACAACTGGTT
TATTAATGCCAGAAGAAGAATAGTACAGCCCATGATTGACCAGTCAAATCGAGCAGGTTTTCTTCTTGAT
CCTTCAGTGAGCCAAGGAGCAGCATATAGTCCAGAGGGTCAGCCCATGGGGAGCTTTGTGTTGGATGGTC
AGCAACACATGGGGATCCGGCCTGCAGGTTTGCAGAGCATGCCAGGGGACTACGTTTCTCAGGGTGGTCC
TATGGGAATGAGTATGGCACAGCCAAGTTACACTCCTCCCCAGATGACCCCACACCCTACTCAATTAAGA
CATGGACCCCCAATGCATTCATATTTGCCAAGCCATCCCCACCACCCAGCCATGATGATGCACGGAGGAC
CCCCTACCCACCCTGGAATGACTATGTCAGCACAGAGCCCCACAATGTTAAATTCTGTAGATCCCAATGT
TGGCGGACAGGTTATGGACATTCATGCCCAATAG


Restriction Sites SgfI-MluI     
ACCN NM_170675
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_170675.4, NP_733775.1
RefSeq Size 3277 bp
RefSeq ORF 1434 bp
Locus ID 4212
Cytogenetics 15q14
Domains homeobox
Protein Families Transcription Factors
Gene Summary 'This gene encodes a homeobox protein belonging to the TALE ('three amino acid loop extension') family of homeodomain-containing proteins. TALE homeobox proteins are highly conserved transcription regulators, and several members have been shown to be essential contributors to developmental programs. Multiple transcript variants encoding distinct isoforms have been described for this gene. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (c) lacks the exon containing the stop codon compared to variant a, that causes a frameshift. The resulting isoform (c) contains a longer and distinct C-terminus compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.