GABRR1 (NM_002042) Human Untagged Clone
CAT#: SC310352
GABRR1 (untagged)-Human gamma-aminobutyric acid (GABA) receptor, rho 1 (GABRR1)
"NM_002042" in other vectors (7)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | GABRR1 |
Synonyms | MGC163216 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_002042, the custom clone sequence may differ by one or more nucleotides
ATGTTGGCTGTCCCAAATATGAGATTTGGCATCTTTCTTTTGTGGTGGGGATGGGTTTTGGCCACTGAAA GCAGAATGCACTGGCCCGGAAGAGAAGTCCACGAGATGTCTAAGAAAGGCAGGCCCCAAAGACAAAGACG AGAAGTACATGAAGATGCCCACAAGCAAGTCAGCCCAATTCTGAGACGAAGTCCTGACATCACCAAATCG CCTCTGACAAAGTCAGAACAGCTTCTGAGGATAGATGACCATGATTTCAGCATGAGGCCTGGCTTTGGAG GCCCTGCCATTCCTGTTGGTGTGGATGTGCAGGTGGAGAGTTTGGATAGCATCTCAGAGGTTGACATGGA CTTTACGATGACCCTCTACCTGAGGCACTACTGGAAGGACGAGAGGCTGTCTTTTCCAAGCACCAACAAC CTCAGCATGACGTTTGACGGCCGGCTGGTCAAGAAGATCTGGGTCCCTGACATGTTTTTCGTGCACTCCA AACGCTCCTTCATCCACGACACCACCACAGACAACGTCATGTTGCGGGTCCAGCCTGATGGGAAAGTGCT CTATAGTCTCAGGGTTACAGTAACTGCAATGTGCAACATGGACTTCAGCCGATTTCCCTTGGACACACAA ACGTGCTCTCTTGAAATTGAAAGCTATGCCTATACAGAAGATGACCTCATGCTGTACTGGAAAAAGGGCA ATGACTCCTTAAAGACAGATGAACGGATCTCACTCTCCCAGTTCCTCATTCAGGAATTCCACACCACCAC CAAACTGGCTTTCTACAGCAGCACAGGCTGGTACAACCGTCTCTACATTAATTTCACGTTGCGTCGCCAC ATCTTCTTCTTCTTGCTCCAAACTTATTTCCCCGCTACCCTGATGGTCATGCTGTCCTGGGTGTCCTTCT GGATCGACCGCAGAGCCGTGCCTGCCAGAGTCCCCTTAGGTATCACAACGGTGCTGACCATGTCCACCAT CATCACGGGCGTGAATGCCTCCATGCCGCGCGTCTCCTACATCAAGGCCGTGGACATCTACCTCTGGGTC AGCTTTGTGTTCGTGTTCCTCTCGGTGCTGGAGTATGCGGCCGTCAACTACCTGACCACTGTGCAGGAGA GGAAGGAACAGAAGCTGCGGGAGAAGCTTCCCTGCACCAGCGGATTACCTCCGCCCCGCACTGCGATGCT GGACGGCAACTACAGTGATGGGGAGGTGAATGACCTGGACAACTACATGCCAGAGAATGGAGAGAAGCCC GACAGGATGATGGTGCAGCTGACCCTGGCCTCAGAGAGGAGCTCCCCACAGAGGAAAAGTCAGAGAAGCA GCTATGTGAGCATGAGAATCGACACCCACGCCATTGATAAATACTCCAGGATCATCTTTCCAGCAGCATA CATTTTATTCAATTTAATATACTGGTCTATTTTCTCCTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_002042 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002042.4, NP_002033.2 |
RefSeq Size | 3174 bp |
RefSeq ORF | 1440 bp |
Locus ID | 2569 |
Cytogenetics | 6q15 |
Protein Families | Druggable Genome, Ion Channels: Cys-loop Receptors, Transmembrane |
Protein Pathways | Neuroactive ligand-receptor interaction |
Gene Summary | 'GABA is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA receptors, which are ligand-gated chloride channels. GABRR1 is a member of the rho subunit family. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]' Transcript Variant: This variant (1) encodes the longest isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC327871 | GABRR1 (untagged)-Human gamma-aminobutyric acid (GABA) receptor rho 1 (GABRR1) |
USD 810.00 |
|
RC217506 | GABRR1 (Myc-DDK-tagged)-Human gamma-aminobutyric acid (GABA) receptor, rho 1 (GABRR1) |
USD 450.00 |
|
RG217506 | GABRR1 (GFP-tagged) - Human gamma-aminobutyric acid (GABA) receptor, rho 1 (GABRR1) |
USD 500.00 |
|
RC217506L1 | Lenti ORF clone of Human gamma-aminobutyric acid (GABA) receptor, rho 1 (GABRR1), Myc-DDK-tagged |
USD 804.00 |
|
RC217506L2 | Lenti ORF clone of Human gamma-aminobutyric acid (GABA) receptor, rho 1 (GABRR1), mGFP tagged |
USD 650.00 |
|
RC217506L3 | Lenti ORF clone of Human gamma-aminobutyric acid (GABA) receptor, rho 1 (GABRR1), Myc-DDK-tagged |
USD 650.00 |
|
RC217506L4 | Lenti ORF clone of Human gamma-aminobutyric acid (GABA) receptor, rho 1 (GABRR1), mGFP tagged |
USD 650.00 |
{0} Product Review(s)
Be the first one to submit a review