Emi1 (FBXO5) (NM_012177) Human Untagged Clone

CAT#: SC310377

FBXO5 (untagged)-Human F-box protein 5 (FBXO5), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: FBXO5
• Synonyms: EMI1; FBX5; Fbxo31
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_012177, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGCCGGCGCCCCTGCAGCTGCGCCCTACGGCCACCCCGCTGCTCCTGCAGCGCCAGCCCCAGCGCAG
  TGACAGCCGCCGGGCGCCCTCGACCCTCGGATAGTTGTAAAGAAGAAAGTTCTACCCTTTCTGTCAAAAT
  GAAGTGTGATTTTAATTGTAACCATGTTCATTCCGGACTTAAACTGGTAAAACCTGATGACATTGGAAGA
  CTAGTTTCCTACACCCCTGCATATTTGGAAGGTTCCTGTAAAGACTGCATTAAAGACTATGAAAGGCTGT
  CATGTATTGGGTCACCGATTGTGAGCCCTAGGATTGTACAACTTGAAACTGAAAGCAAGCGCTTGCATAA
  CAAGGAAAATCAACATGTGCAACAGACACTTAATAGTACAAATGAAATAGAAGCACTAGAGACCAGTAGA
  CTTTATGAAGACAGTGGCTATTCCTCATTTTCTCTACAAAGTGGCCTCAGTGAACATGAAGAAGGTAGCC
  TCCTGGAGGAGAATTTCGGTGACAGTCTACAATCCTGCCTGCTACAAATACAAAGCCCAGACCAATATCC
  CAACAAAAACTTGCTGCCAGTTCTTCATTTTGAAAAAGTGGTTTGTTCAACATTAAAAAAGAATGCAAAA
  CGAAATCCTAAAGTAGATCGGGAGATGCTGAAGGAAATTATAGCCAGAGGAAATTTTAGACTGCAGAATA
  TAATTGGCAGAAAAATGGGCCTAGAATGTGTAGATATTCTCAGCGAACTCTTTCGAAGGGGACTCAGACA
  TGTCTTAGCAACTATTTTAGCACAACTCAGTGACATGGACTTAATCAATGTGTCTAAAGTGAGCACAACT
  TGGAAGAAGATCCTAGAAGATGATAAGGGGGCATTCCAGTTGTACAGTAAAGCAATACAAAGAGTTACCG
  AAAACAACAATAAATTTTCACCTCATGCTTCAACCAGAGAATATGTTATGTTCAGAACCCCACTGGCTTC
  TGTTCAGAAATCAGCAGCCCAGACTTCTCTCAAAAAAGATGCTCAAACCAAGTTATCCAATCAAGGTGAT
  CAGAAAGGTTCTACTTATAGTCGACACAATGAATTCTCTGAGGTTGCCAAGACATTGAAAAAGAACGAAA
  GCCTCAAAGCCTGTATTCGCTGTAATTCACCTGCAAAATATGATTGCTATTTACAACGGGCAACCTGCAA
  ACGAGAAGGCTGTGGATTTGATTATTGTACGAAGTGTCTCTGTAATTATCATACTACTAAAGACTGTTCA
  GATGGCAAGCTCCTCAAAGCCAGTTGTAAAATAGGTCCCCTGCCTGGTACAAAGAAAAGCAAAAAGAATT
  TACGAAGATTGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_012177
• ORF Size: 1344 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_012177.3, NP_036309.1
• RefSeq Size: 2109
• RefSeq ORF: 1344
• Locus ID: 26271
• Domains: F-box
• Protein Families: Druggable Genome
• Protein Pathways: Oocyte meiosis
• Gene Summary: This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. This protein is similar to xenopus early mitotic inhibitor-1 (Emi1), which is a mitotic regulator that interacts with Cdc20 and inhibits the anaphase promoting complex. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Dec 2008]
  Transcript Variant: This variant (1) represents the shorter transcript but encodes the longer isoform (a).