TULP3 (NM_003324) Human Untagged Clone
CAT#: SC310386
TULP3 (untagged)-Human tubby like protein 3 (TULP3), transcript variant 1
"NM_003324" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | TULP3 |
Synonyms | TUBL3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_003324, the custom clone sequence may differ by one or more nucleotides
ATGGAGGCTTCGCGCTGCCGGCTCAGTCCCAGCGGCGACAGTGTCTTCCATGAAGAAATG ATGAAGATGCGACAGGCTAAGCTGGATTATCAGAGGCTACTACTTGAGAAGAGGCAAAGG AAAAAGCGCCTTGAGCCATTTATGGTGCAGCCCAATCCAGAAGCCAGGCTACGTCGGGCA AAGCCAAGGGCCAGTGATGAGCAGACTCCCTTGGTGAACTGTCATACTCCCCACAGCAAT GTCATCTTACATGGTATTGATGGTCCAGCTGCTGTCCTGAAACCAGACGAAGTTCATGCT CCATCAGTAAGCTCCTCTGTTGTGGAAGAAGATGCTGAAAACACCGTGGATACTGCTTCC AAGCCAGGACTTCAGGAGCGTCTCCAAAAGCATGATATCTCTGAAAGTGTGAACTTCGAT GAGGAGACTGATGGAATATCCCAGTCAGCATGTTTAGAAAGACCCAATTCTGCATCAAGC CAGAATTCAACCGATACAGGCACTTCCGGTTCTGCTACTGCCGCCCAACCAGCTGATAAC CTCCTGGGAGACATAGACGACCTGGAGGACTTTGTGTATAGTCCTGCCCCTCAAGGTGTC ACAGTAAGATGTCGGATAATCCGGGATAAAAGGGGAATGGATCGGGGTCTCTTCCCCACC TACTATATGTACTTGGAAAAAGAAGAAAATCAGAAGATATTTCTTCTTGCAGCTAGAAAG CGGAAAAAGAGCAAAACAGCCAACTACCTTATCTCCATTGATCCAGTTGATTTATCTCGT GAAGGAGAAAGTTATGTCGGCAAGCTTAGATCCAACCTCATGGGGACCAAGTTTACAGTT TATGACCGTGGCATCTGCCCCATGAAGGGCCGGGGTTTGGTAGGAGCGGCCCACACCCGG CAGGAGCTGGCTGCCATCTCCTATGAAACAAACGTACTTGGATTTAAAGGTCCTAGGAAA ATGTCTGTGATCATTCCTGGAATGACACTGAATCATAAGCAGATCCCCTATCAGCCACAA AACAACCATGACAGTTTGCTCTCAAGGTGGCAGAACAGAACTATGGAAAATCTGGTTGAG CTGCACAACAAGGCCCCCGTCTGGAACAGTGACACTCAGTCCTATGTCCTCAACTTCCGT GGCCGGGTCACTCAGGCGTCTGTGAAGAACTTCCAGATAGTCCACAAAAATGACCCTGAT TATATAGTCATGCAGTTTGGACGTGTGGCAGATGACGTGTTCACACTGGATTACAACTAC CCACTTTGTGCAGTACAGGCCTTTGGCATCGGTCTTTCTAGCTTTGACAGTAAGCTGGCG TGTGAATGA |
Restriction Sites | Please inquire |
ACCN | NM_003324 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_003324.3, NP_003315.2 |
RefSeq Size | 2945 bp |
RefSeq ORF | 1329 bp |
Locus ID | 7289 |
Cytogenetics | 12p13.33 |
Domains | Tub |
Protein Families | Druggable Genome, Transcription Factors |
Gene Summary | 'This gene encodes a member of the tubby gene family of bipartite transcription factors. Members of this family have been identified in plants, vertebrates, and invertebrates, and they share a conserved N-terminal transcription activation region and a conserved C-terminal DNA and phosphatidylinositol-phosphate binding region. The encoded protein binds to phosphoinositides in the plasma membrane via its C-terminal region and probably functions as a membrane-bound transcription regulator that translocates to the nucleus in response to phosphoinositide hydrolysis, for instance, induced by G-protein-coupled-receptor signaling. It plays an important role in neuronal development and function. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, May 2009]' Transcript Variant: This variant (1) represents the longer transcript but encodes the shorter isoform (1). |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC207595 | TULP3 (Myc-DDK-tagged)-Human tubby like protein 3 (TULP3), transcript variant 1 |
USD 420.00 |
|
RG207595 | TULP3 (GFP-tagged) - Human tubby like protein 3 (TULP3), transcript variant 1 |
USD 460.00 |
|
RC207595L1 | Lenti ORF clone of Human tubby like protein 3 (TULP3), transcript variant 1, Myc-DDK-tagged |
USD 768.00 |
|
RC207595L2 | Lenti ORF clone of Human tubby like protein 3 (TULP3), transcript variant 1, mGFP tagged |
USD 620.00 |
|
RC207595L3 | Lenti ORF clone of Human tubby like protein 3 (TULP3), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC207595L4 | Lenti ORF clone of Human tubby like protein 3 (TULP3), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review