GJA8 (NM_005267) Human Untagged Clone

CAT#: SC310398

GJA8 (untagged)-Human gap junction protein, alpha 8, 50kDa (GJA8)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GJA8
• Synonyms: CAE; CAE1; CTRCT1; CX50; CZP1; MP70
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_005267, the custom clone sequence may differ by one or more nucleotides
  ATGGGCGACTGGAGTTTCCTGGGGAACATCTTGGAGGAGGTGAATGAGCACTCCACCGTC
  ATCGGCAGAGTCTGGCTCACCGTGCTTTTCATCTTCCGGATCCTCATCCTTGGCACGGCC
  GCAGAGTTCGTGTGGGGGGATGAGCAATCCGACTTCGTGTGCAACACCCAGCAGCCTGGC
  TGCGAGAACGTCTGCTACGACGAGGCCTTTCCCATCTCCCACATTCGCCTCTGGGTGCTG
  CAGATCATCTTCGTCTCCACCCCGTCCCTGATGTACGTGGGGCACGCGGTGCACTACGTC
  CGCATGGAGGAGAAGCGCAAAAGCCGCGAGGCGGAGGAGCTGGGCCAGCAGGCGGGGACT
  AACGGCGGCCCGGACCAGGGCAGCGTCAAGAAGAGCAGCGGCAGCAAAGGCACTAAGAAG
  TTCCGGCTGGAGGGGACCCTGCTGAGGACCTACATCTGCCACATCATCTTCAAGACCCTC
  TTTGAAGTGGGCTTCATCGTGGGCCACTACTTCCTGTACGGGTTCCGGATCCTGCCTCTG
  TACCGCTGCAGCCGGTGGCCCTGCCCCAATGTGGTGGACTGCTTCGTGTCCCGGCCCACG
  GAGAAAACCATCTTCATCCTGTTCATGTTGTCTGTGGCCTCTGTGTCCCTATTCCTCAAC
  GTGATGGAGTTGGGCCACCTGGGCCTGAAGGGGATCCGGTCTGCCTTGAAGAGGCCTGTA
  GAGCAGCCCCTGGGGGAGATTCCTGAGAAATCCCTCCACTCCATTGCTGTCTCCTCCATC
  CAGAAAGCCAAGGGCTATCAGCTCCTAGAAGAAGAGAAAATCGTTTCCCACTATTTCCCC
  TTGACCGAGGTTGGGATGGTGGAGACCAGCCCACTGCCTGCCAAGCCTTTCAATCAGTTC
  GAGGAGAAGATCAGCACAGGACCCCTGGGGGACTTGTCCCGGGGCTACCAAGAGACACTG
  CCTTCCTACGCTCAGGTGGGGGCACAAGAAGTGGAGGGCGAGGGGCCGCCTGCAGAGGAG
  GGAGCCGAACCCGAGGTGGGAGAGAAGAAGGAGGAAGCAGAGAGGCTGACCACGGAGGAG
  CAGGAGAAGGTGGCCGTGCCAGAGGGGGAGAAAGTAGAGACCCCCGGAGTGGATAAGGAG
  GGTGAAAAAGAAGAGCCGCAGTCGGAGAAGGTGTCAAAGCAAGGGCTGCCAGCTGAGAAG
  ACACCTTCACTCTGTCCAGAGCTGACAACAGATGATGCCAGACCCCTGAGCAGGCTAAGC
  AAAGCCAGCAGCCGAGCCAGGTCAGACGATCTAACCGTATGA
  
• Restriction Sites: Please inquire
• ACCN: NM_005267
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_005267.3, NP_005258.2
• RefSeq Size: 1374 bp
• RefSeq ORF: 1302 bp
• Locus ID: 2703
• Cytogenetics: 1q21.2
• Protein Families: Druggable Genome, Ion Channels: Other, Transmembrane
• Gene Summary: 'This gene encodes a transmembrane connexin protein that is necessary for lens growth and maturation of lens fiber cells. The encoded protein is a component of gap junction channels and functions in a calcium and pH-dependent manner. Mutations in this gene have been associated with zonular pulverulent cataracts, nuclear progressive cataracts, and cataract-microcornea syndrome. [provided by RefSeq, Dec 2009]'