TEF1 (TEAD1) (NM_021961) Human Untagged Clone

CAT#: SC310426

TEAD1 (untagged)-Human TEA domain family member 1 (SV40 transcriptional enhancer factor) (TEAD1)


  "NM_021961" in other vectors (6)

Reconstitution Protocol

SC310426 is the updated version of SC112830.

USD 720.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "TEAD1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TEAD1
Synonyms AA; NTEF-1; REF1; TCF-13; TCF13; TEAD-1; TEF-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_021961, the custom clone sequence may differ by one or more nucleotides


ATTGAGCCCAGCAGCTGGAGCGGCAGTGAGAGCCCTGCCGAAAACATGGAAAGGATGAGTGACTCTGCAG
ATAAGCCAATTGACAATGATGCAGAAGGGGTCTGGAGCCCCGACATCGAGCAAAGCTTTCAGGAGGCCCT
GGCTATCTATCCACCATGTGGGAGGAGGAAAATCATCTTATCAGACGAAGGCAAAATGTATGGTAGGAAT
GAATTGATAGCCAGATACATCAAACTCAGGACAGGCAAGACGAGGACCAGAAAACAGGTGTCTAGTCACA
TTCAGGTTCTTGCCAGAAGGAAATCTCGTGATTTTCATTCCAAGCTAAAGGATCAGACTGCAAAGGATAA
GGCCCTGCAGCACATGGCGGCCATGTCCTCAGCCCAGATCGTCTCGGCCACTGCCATTCATAACAAGCTG
GGGCTGCCTGGGATTCCACGCCCGACCTTCCCAGGGGCGCCGGGGTTCTGGCCGGGAATGATTCAAACAG
GGCAGCCAGGATCCTCACAAGACGTCAAGCCTTTTGTGCAGCAGGCCTACCCCATCCAGCCAGCGGTCAC
AGCCCCCATTCCAGGGTTTGAGCCTGCATCGGCCCCAGCTCCCTCAGTCCCTGCCTGGCAAGGTCGCTCC
ATTGGCACAACCAAGCTTCGCCTGGTGGAATTTTCAGCTTTTCTCGAGCAGCAGCGAGACCCAGACTCGT
ACAACAAACACCTCTTCGTGCACATTGGGCATGCCAACCATTCTTACAGTGACCCATTGCTTGAATCAGT
GGACATTCGTCAGATTTATGACAAATTTCCTGAAAAGAAAGGTGGCTTAAAGGAACTGTTTGGAAAGGGC
CCTCAAAATGCCTTCTTCCTCGTAAAATTCTGGGCTGATTTAAACTGCAATATTCAAGATGATGCTGGGG
CTTTTTATGGTGTAACCAGTCAGTACGAGAGTTCTGAAAATATGACAGTCACCTGTTCCACCAAAGTTTG
CTCCTTTGGGAAGCAAGTAGTAGAAAAAGTAGAGACGGAGTATGCAAGGTTTGAGAATGGCCGATTTGTA
TACCGAATAAACCGCTCCCCAATGTGTGAATATATGATCAACTTCATCCACAAGCTCAAACACTTACCAG
AGAAATATATGATGAACAGTGTTTTGGAAAACTTCACAATTTTATTGGTGGTAACAAACAGGGATACACA
AGAAACTCTACTCTGCATGGCCTGTGTGTTTGAAGTTTCAAATAGTGAACACGGAGCACAACATCATATT
TACAGGCTTGTAAAGGACTGA


Restriction Sites SgfI-MluI     
ACCN NM_021961
Insert Size 1281 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_021961.5, NP_068780.2
RefSeq Size 9433 bp
RefSeq ORF 1281 bp
Locus ID 7003
Cytogenetics 11p15.3
Domains TEA
Protein Families Transcription Factors
Gene Summary 'This gene encodes a ubiquitous transcriptional enhancer factor that is a member of the TEA/ATTS domain family. This protein directs the transactivation of a wide variety of genes and, in placental cells, also acts as a transcriptional repressor. Mutations in this gene cause Sveinsson's chorioretinal atrophy. Additional transcript variants have been described but their full-length natures have not been experimentally verified. [provided by RefSeq, May 2010]'

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.