5HT4 Receptor (HTR4) (NM_000870) Human Untagged Clone

CAT#: SC310455

HTR4 (untagged)-Human 5-hydroxytryptamine (serotonin) receptor 4 (HTR4), transcript variant b


  "NM_000870" in other vectors (4)

Reconstitution Protocol

USD 760.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "HTR4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HTR4
Synonyms 5-HT4; 5-HT4R
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_000870 edited
TAATGGACAAACTTGATGCTAATGTGAGTTCTGAGGAGGGTTTCGGGTCAGTGGAGAAGG
TGGTGCTGCTCACGTTTCTCTCGACGGTTATCCTGATGGCCATCTTGGGGAACCTGCTGG
TGATGGTGGCTGTGTGCTGGGACAGGCAGCTCAGGAAAATAAAAACAAATTATTTCATTG
TATCTCTTGCTTTTGCGGATCTGCTGGTTTCGGTGCTGGTGATGCCCTTTGGTGCCATTG
AGCTGGTTCAAGACATCTGGATTTATGGGGAGGTGTTTTGTCTTGTTCGGACATCTCTGG
ACGTCCTGCTCACAACGGCATCGATTTTTCACCTGTGCTGCATTTCTCTGGATAGGTATT
ACGCCATCTGCTGCCAGCCTTTGGTCTATAGGAACAAGATGACCCCTCTGCGCATCGCAT
TAATGCTGGGAGGCTGCTGGGTCATCCCCACGTTTATTTCTTTTCTCCCTATAATGCAAG
GCTGGAATAACATTGGCATAATTGATTTGATAGAAAAGAGGAAGTTCAACCAGAACTCTA
ACTCTACGTACTGTGTCTTCATGGTCAACAAGCCCTACGCCATCACCTGCTCTGTGGTGG
CCTTCTACATCCCATTTCTCCTCATGGTGCTGGCCTATTACCGCATCTATGTCACAGCTA
AGGAGCATGCCCATCAGATCCAGATGTTACAACGGGCAGGAGCCTCCTCCGAGAGCAGGC
CTCAGTCGGCAGACCAGCATAGCACTCATCGCATGAGGACAGAGACCAAAGCAGCCAAGA
CCCTGTGCATCATCATGGGTTGCTTCTGCCTCTGCTGGGCACCATTCTTTGTCACCAATA
TTGTGGATCCTTTCATAGACTACACTGTCCCTGGGCAGGTGTGGACTGCTTTCCTCTGGC
TCGGCTATATCAATTCCGGGTTGAACCCTTTTCTCTACGCCTTCTTGAATAAGTCTTTTA
GACGTGCCTTCCTCATCATCCTCTGCTGTGATGATGAGCGCTACCGAAGACCTTCCATTC
TGGGCCAGACTGTCCCTTGTTCAACCACAACCATTAATGGATCCACACATGTACTAAGGG
ATGCAGTGGAGTGTGGTGGCCAGTGGGAGAGTCAGTGTCACCCGCCAGCAACTTCTCCTT
TGGTGGCTGCTCAGCCCAGTGACACTTAGGCCCCTGGGACAATGACCCAGAAGACAGCCA
T
Restriction Sites Please inquire     
ACCN NM_000870
Insert Size 1200 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_000870.1.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_000870.2, NP_000861.1
RefSeq Size 3005 bp
RefSeq ORF 1167 bp
Locus ID 3360
Cytogenetics 5q32
Domains 7tm_1
Protein Families Druggable Genome, GPCR, Transmembrane
Protein Pathways Calcium signaling pathway, Neuroactive ligand-receptor interaction
Gene Summary 'This gene is a member of the family of serotonin receptors, which are G protein coupled receptors that stimulate cAMP production in response to serotonin (5-hydroxytryptamine). The gene product is a glycosylated transmembrane protein that functions in both the peripheral and central nervous system to modulate the release of various neurotransmitters. Multiple transcript variants encoding proteins with distinct C-terminal sequences have been described. [provided by RefSeq, May 2010]'
Transcript Variant: This variant (b) encodes the longest isoform (b). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.