WARS2 (NM_015836) Human Untagged Clone

CAT#: SC310498

WARS2 (untagged)-Human tryptophanyl tRNA synthetase 2, mitochondrial (WARS2), nuclear gene encoding mitochondrial protein, transcript variant 1


  "NM_015836" in other vectors (6)

Reconstitution Protocol

USD 760.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "WARS2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol WARS2
Synonyms mtTrpRS; NEMMLAS; TrpRS
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_015836, the custom clone sequence may differ by one or more nucleotides


ATGGCGCTGCACTCAATGCGGAAAGCGCGTGAGCGCTGGAGCTTCATCCGGGCACTTCATAAGGGATCCG
CAGCTGCTCCCGCTCTCCAGAAAGACAGCAAGAAGCGAGTATTTTCCGGCATTCAACCTACAGGAATCCT
CCACCTGGGCAATTACCTGGGAGCCATTGAGAGCTGGGTGAGGTTACAGGATGAATATGACTCTGTATTA
TACAGCATTGTTGACCTCCACTCCATTACTGTCCCCCAAGACCCAGCTGTCCTTCGGCAGAGCATCCTGG
ACATGACTGCTGTTCTTCTTGCCTGTGGCATAAACCCGGAAAAAAGCATCCTTTTCCAACAATCTCAGGT
GTCTGAACACACACAATTAAGTTGGATCCTTTCCTGCATGGTCAGACTACCTCGATTACAACATTTACAT
CAGTGGAAGGCAAAGACTACCAAGCAGAAGCACGATGGCACGGTGGGCCTGCTCACATACCCAGTACTCC
AGGCAGCCGACATTCTGTTGTACAAGTCCACACACGTTCCTGTTGGGGAGGATCAAGTCCAGCACATGGA
ACTAGTTCAGGATCTAGCACAAGGTTTCAACAAGAAGTATGGGGAGTTCTTTCCAGTGCCCGAGTCCATT
CTCACATCCATGAAGAAGGTAAAATCCCTACGTGATCCTTCTGCCAAAATGTCGAAATCAGACCCTGACA
AACTGGCCACCGTCCGAATAACAGACAGCCCAGAGGAGATAGTGCAGAAATTCCGCAAGGCTGTGACAGA
CTTCACCTCGGAGGTCACCTATGACCCGGCTGGCCGCGCTGGCGTGTCCAACATAGTGGCGGTGCATGCC
GCGGTGACGGGGCTCTCCGTGGAGGAAGTGGTGCGCCGCAGCGCGGGCATGAACACTGCTCGCTACAAGC
TGGCCGTGGCAGATGCTGTGATTGAGAAGTTTGCCCCAATTAAGCGTGAAATTGAAAAACTGAAGCTGGA
CAAGGACCATTTAGAGAAGGTTTTACAAATTGGATCAGCAAAAGCCAAAGAATTAGCATACACTGTGTGC
CAGGAGGTGAAGAAATTGGTGGGTTTTCTATAG


Restriction Sites SgfI-MluI     
ACCN NM_015836
ORF Size 1083 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_015836.3, NP_056651.1
RefSeq Size 2806
RefSeq ORF 1083
Locus ID 10352
Domains tRNA-synt_1b
Protein Families Druggable Genome
Protein Pathways Aminoacyl-tRNA biosynthesis, Tryptophan metabolism
Gene Summary Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Two forms of tryptophanyl-tRNA synthetase exist, a cytoplasmic form, named WARS, and a mitochondrial form, named WARS2. This gene encodes the mitochondrial tryptophanyl-tRNA synthetase. Two alternative transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the shorter transcript but encodes the longer protein (isoform 1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.