CCR9 (NM_006641) Human Untagged Clone
CAT#: SC310507
CCR9 (untagged)-Human chemokine (C-C motif) receptor 9 (CCR9), transcript variant B
"NM_006641" in other vectors (6)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | CCR9 |
| Synonyms | CC-CKR-9; CDw199; GPR-9-6; GPR28 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_006641, the custom clone sequence may differ by one or more nucleotides
ATGGCTGATGACTATGGCTCTGAATCCACATCTTCCATGGAAGACTACGTTAACTTCAACTTCACTGACT TCTACTGTGAGAAAAACAATGTCAGGCAGTTTGCGAGCCATTTCCTCCCACCCTTGTACTGGCTCGTGTT CATCGTGGGTGCCTTGGGCAACAGTCTTGTTATCCTTGTCTACTGGTACTGCACAAGAGTGAAGACCATG ACCGACATGTTCCTTTTGAATTTGGCAATTGCTGACCTCCTCTTTCTTGTCACTCTTCCCTTCTGGGCCA TTGCTGCTGCTGACCAGTGGAAGTTCCAGACCTTCATGTGCAAGGTGGTCAACAGCATGTACAAGATGAA CTTCTACAGCTGTGTGTTGCTGATCATGTGCATCAGCGTGGACAGGTACATTGCCATTGCCCAGGCCATG AGAGCACATACTTGGAGGGAGAAAAGGCTTTTGTACAGCAAAATGGTTTGCTTTACCATCTGGGTATTGG CAGCTGCTCTCTGCATCCCAGAAATCTTATACAGCCAAATCAAGGAGGAATCCGGCATTGCTATCTGCAC CATGGTTTACCCTAGCGATGAGAGCACCAAACTGAAGTCAGCTGTCTTGACCCTGAAGGTCATTCTGGGG TTCTTCCTTCCCTTCGTGGTCATGGCTTGCTGCTATACCATCATCATTCACACCCTGATACAAGCCAAGA AGTCTTCCAAGCACAAAGCCCTAAAAGTGACCATCACTGTCCTGACCGTCTTTGTCTTGTCTCAGTTTCC CTACAACTGCATTTTGTTGGTGCAGACCATTGACGCCTATGCCATGTTCATCTCCAACTGTGCCGTTTCC ACCAACATTGACATCTGCTTCCAGGTCACCCAGACCATCGCCTTCTTCCACAGTTGCCTGAACCCTGTTC TCTATGTTTTTGTGGGTGAGAGATTCCGCCGGGATCTCGTGAAAACCCTGAAGAACTTGGGTTGCATCAG CCAGGCCCAGTGGGTTTCATTTACAAGGAGAGAGGGAAGCTTGAAGCTGTCGTCTATGTTGCTGGAGACA ACCTCAGGAGCACTCTCCCTCTGA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_006641 |
| ORF Size | 1074 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Reference Data | |
| RefSeq | NM_006641.3, NP_006632.2 |
| RefSeq Size | 2518 |
| RefSeq ORF | 1074 |
| Locus ID | 10803 |
| Protein Families | Druggable Genome, GPCR, Transmembrane |
| Protein Pathways | Chemokine signaling pathway, Cytokine-cytokine receptor interaction |
| Gene Summary | The protein encoded by this gene is a member of the beta chemokine receptor family. It is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. Chemokines and their receptors are key regulators of the thymocytes migration and maturation in normal and inflammation conditions. The specific ligand of this receptor is CCL25. It has been found that this gene is differentially expressed by T lymphocytes of small intestine and colon, suggested a role in the thymocytes recruitment and development that may permit functional specialization of immune responses in different segment of the gastrointestinal tract. This gene is mapped to the chemokine receptor gene cluster region. Two alternatively spliced transcript variants have been described. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012] Transcript Variant: This variant (B) lacks an internal exon and initiates translation at a downstream, in-frame start codon, compared to variant 1. Variants B and C encode the same isoform (B), which has a shorter N-terminus compared to isoform A. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC210246 | CCR9 (Myc-DDK-tagged)-Human chemokine (C-C motif) receptor 9 (CCR9), transcript variant B |
USD 457.00 |
|
| RG210246 | CCR9 (GFP-tagged) - Human chemokine (C-C motif) receptor 9 (CCR9), transcript variant B |
USD 460.00 |
|
| RC210246L1 | Lenti ORF clone of Human chemokine (C-C motif) receptor 9 (CCR9), transcript variant B, Myc-DDK-tagged |
USD 768.00 |
|
| RC210246L2 | Lenti ORF clone of Human chemokine (C-C motif) receptor 9 (CCR9), transcript variant B, mGFP tagged |
USD 620.00 |
|
| RC210246L3 | Lenti ORF clone of Human chemokine (C-C motif) receptor 9 (CCR9), transcript variant B, Myc-DDK-tagged |
USD 620.00 |
|
| RC210246L4 | Lenti ORF clone of Human chemokine (C-C motif) receptor 9 (CCR9), transcript variant B, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China