CCR9 (NM_006641) Human Untagged Clone

CAT#: SC310507

CCR9 (untagged)-Human chemokine (C-C motif) receptor 9 (CCR9), transcript variant B

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CCR9
• Synonyms: CC-CKR-9; CDw199; GPR-9-6; GPR28
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_006641, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCTGATGACTATGGCTCTGAATCCACATCTTCCATGGAAGACTACGTTAACTTCAACTTCACTGACT
  TCTACTGTGAGAAAAACAATGTCAGGCAGTTTGCGAGCCATTTCCTCCCACCCTTGTACTGGCTCGTGTT
  CATCGTGGGTGCCTTGGGCAACAGTCTTGTTATCCTTGTCTACTGGTACTGCACAAGAGTGAAGACCATG
  ACCGACATGTTCCTTTTGAATTTGGCAATTGCTGACCTCCTCTTTCTTGTCACTCTTCCCTTCTGGGCCA
  TTGCTGCTGCTGACCAGTGGAAGTTCCAGACCTTCATGTGCAAGGTGGTCAACAGCATGTACAAGATGAA
  CTTCTACAGCTGTGTGTTGCTGATCATGTGCATCAGCGTGGACAGGTACATTGCCATTGCCCAGGCCATG
  AGAGCACATACTTGGAGGGAGAAAAGGCTTTTGTACAGCAAAATGGTTTGCTTTACCATCTGGGTATTGG
  CAGCTGCTCTCTGCATCCCAGAAATCTTATACAGCCAAATCAAGGAGGAATCCGGCATTGCTATCTGCAC
  CATGGTTTACCCTAGCGATGAGAGCACCAAACTGAAGTCAGCTGTCTTGACCCTGAAGGTCATTCTGGGG
  TTCTTCCTTCCCTTCGTGGTCATGGCTTGCTGCTATACCATCATCATTCACACCCTGATACAAGCCAAGA
  AGTCTTCCAAGCACAAAGCCCTAAAAGTGACCATCACTGTCCTGACCGTCTTTGTCTTGTCTCAGTTTCC
  CTACAACTGCATTTTGTTGGTGCAGACCATTGACGCCTATGCCATGTTCATCTCCAACTGTGCCGTTTCC
  ACCAACATTGACATCTGCTTCCAGGTCACCCAGACCATCGCCTTCTTCCACAGTTGCCTGAACCCTGTTC
  TCTATGTTTTTGTGGGTGAGAGATTCCGCCGGGATCTCGTGAAAACCCTGAAGAACTTGGGTTGCATCAG
  CCAGGCCCAGTGGGTTTCATTTACAAGGAGAGAGGGAAGCTTGAAGCTGTCGTCTATGTTGCTGGAGACA
  ACCTCAGGAGCACTCTCCCTCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_006641
• ORF Size: 1074 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_006641.3, NP_006632.2
• RefSeq Size: 2518
• RefSeq ORF: 1074
• Locus ID: 10803
• Protein Families: Druggable Genome, GPCR, Transmembrane
• Protein Pathways: Chemokine signaling pathway, Cytokine-cytokine receptor interaction
• Gene Summary: The protein encoded by this gene is a member of the beta chemokine receptor family. It is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. Chemokines and their receptors are key regulators of the thymocytes migration and maturation in normal and inflammation conditions. The specific ligand of this receptor is CCL25. It has been found that this gene is differentially expressed by T lymphocytes of small intestine and colon, suggested a role in the thymocytes recruitment and development that may permit functional specialization of immune responses in different segment of the gastrointestinal tract. This gene is mapped to the chemokine receptor gene cluster region. Two alternatively spliced transcript variants have been described. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
  Transcript Variant: This variant (B) lacks an internal exon and initiates translation at a downstream, in-frame start codon, compared to variant 1. Variants B and C encode the same isoform (B), which has a shorter N-terminus compared to isoform A.