BCCIP (NM_016567) Human Untagged Clone
CAT#: SC310535
BCCIP (untagged)-Human BRCA2 and CDKN1A interacting protein (BCCIP), transcript variant A
"NM_016567" in other vectors (6)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | BCCIP |
| Synonyms | TOK-1; TOK1 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_016567, the custom clone sequence may differ by one or more nucleotides
ATGGCGTCCAGGTCTAAGCGGCGTGCCGTGGAAAGTGGGGTTCCGCAGCCGCCGGATCCCCCAGTCCAGC GCGACGAGGAAGAGGAAAAAGAAGTCGAAAATGAGGATGAAGACGATGATGACAGTGACAAGGAAAAGGA TGAAGAGGACGAGGTCATTGACGAGGAAGTGAATATTGAATTTGAAGCTTATTCCCTATCAGATAATGAT TATGACGGAATTAAGAAATTACTGCAGCAGCTTTTTCTAAAGGCTCCTGTGAACACTGCAGAACTAACAG ATCTCTTAATTCAACAGAACCATATTGGGAGTGTGATTAAGCAAACGGATGTTTCAGAAGACAGCAATGA TGATATGGATGAAGATGAGGTTTTTGGTTTCATAAGCCTTTTAAATTTAACTGAAAGAAAGGGTACCCAG TGTGTTGAACAAATTCAAGAGTTGGTTCTACGCTTCTGTGAGAAGAACTGTGAAAAGAGCATGGTTGAAC AGCTGGACAAGTTTTTAAATGACACCACCAAGCCTGTGGGCCTTCTCCTAAGTGAAAGATTCATTAATGT CCCTCCACAGATCGCTCTGCCCATGTACCAGCAGCTTCAGAAAGAACTGGCGGGGGCACACAGAACCAAT AAGCCATGTGGGAAGTGCTACTTTTACCTTCTGATTAGTAAGACATTTGTGGAAGCAGGAAAAAACAATT CCAAAAAGAAACCTAGCAACAAAAAGAAAGCTGCGTTAATGTTTGCAAATGCAGAGGAAGAATTTTTCTA TGAGGAGCAGGGAAAACCTGAGGTGCTTGGAGGTCCAGACACAAGAAGAGGATTGGAACCAGTTCCGATA CAGCACAATGGTGGTTCACGGGGGCAAGTGACAGCCCTGGTTTCTCTGAAGGCTGGACTAATTCAATCAA GATCAACTCTAAGTGATTTCCAGGGAACCTTCATGACTGTTGGAATTGCTCTGTCATAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_016567 |
| ORF Size | 969 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Reference Data | |
| RefSeq | NM_016567.3, NP_057651.1 |
| RefSeq Size | 1461 |
| RefSeq ORF | 969 |
| Locus ID | 56647 |
| Protein Families | Druggable Genome, Stem cell - Pluripotency |
| Gene Summary | This gene product was isolated on the basis of its interaction with BRCA2 and p21 proteins. It is an evolutionarily conserved nuclear protein with multiple interacting domains. The N-terminal half shares moderate homology with regions of calmodulin and M-calpain, suggesting that it may also bind calcium. Functional studies indicate that this protein may be an important cofactor for BRCA2 in tumor suppression, and a modulator of CDK2 kinase activity via p21. This protein has also been implicated in the regulation of BRCA2 and RAD51 nuclear focus formation, double-strand break-induced homologous recombination, and cell cycle progression. Multiple transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (A) encodes the longest isoform (BCCIPalpha, which is also known as TOK-1alpha). BCCIPalpha has a different C-terminus compared to isoforms BCCIPbeta and C, and has been the subject of most functional studies. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC220795 | BCCIP (Myc-DDK-tagged)-Human BRCA2 and CDKN1A interacting protein (BCCIP), transcript variant A |
USD 300.00 |
|
| RG220795 | BCCIP (GFP-tagged) - Human BRCA2 and CDKN1A interacting protein (BCCIP), transcript variant A |
USD 460.00 |
|
| RC220795L1 | Lenti ORF clone of Human BRCA2 and CDKN1A interacting protein (BCCIP), transcript variant A, Myc-DDK-tagged |
USD 768.00 |
|
| RC220795L2 | Lenti ORF clone of Human BRCA2 and CDKN1A interacting protein (BCCIP), transcript variant A, mGFP tagged |
USD 620.00 |
|
| RC220795L3 | Lenti ORF clone of Human BRCA2 and CDKN1A interacting protein (BCCIP), transcript variant A, Myc-DDK-tagged |
USD 620.00 |
|
| RC220795L4 | Lenti ORF clone of Human BRCA2 and CDKN1A interacting protein (BCCIP), transcript variant A, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China