BRCC36 (BRCC3) (NM_024332) Human Untagged Clone

CAT#: SC310541

BRCC3 (untagged)-Human BRCA1/BRCA2-containing complex, subunit 3 (BRCC3), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: BRCC3
• Synonyms: BRCC36; C6.1A; CXorf53
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_024332, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGGTGCAGGTGGTGCAGGCGGTGCAGGCGGTTCATCTCGAGTCTGACGCTTTCCTCGTTTGTCTCA
  ACCACGCTCTGAGCACAGAGAAGGAGGAAGTAATGGGGCTGTGCATAGGGGAGTTGAACGATGATACAAG
  GAGTGACTCCAAATTTGCATATACTGGAACTGAAATGCGCACAGTTGCTGAAAAGGTTGATGCCGTCAGA
  ATTGTTCACATTCATTCTGTCATCATCTTACGACGTTCTGATAAGAGGAAGGACCGAGTAGAAATTTCTC
  CAGAGCAGCTGTCTGCAGCTTCAACAGAGGCAGAGAGGTTGGCTGAACTGACAGGCCGCCCCATGAGAGT
  TGTGGGCTGGTATCATTCCCATCCTCATATAACTGTTTGGCCTTCACATGTTGATGTTCGCACACAAGCC
  ATGTACCAGATGATGGATCAAGGCTTTGTAGGACTTATTTTTTCCTGTTTCATAGAAGATAAGAACACAA
  AGACTGGCCGGGTACTCTACACTTGCTTCCAATCCATACAGGCCCAAAAGAGTTCAGAGTCCCTTCATGG
  TCCACGAGACTTCTGGAGCTCCAGCCAGCACATCTCCATTGAGGGCCAGAAGGAAGAGGAAAGGTATGAG
  AGAATCGAAATCCCAATCCATATTGTACCTCATGTCACTATCGGGAAAGTGTGCCTTGAATCAGCAGTAG
  AGCTGCCCAAGATCCTGTGCCAGGAGGAGCAGGATGCGTATAGGAGGATCCACAGCCTTACACATCTGGA
  CTCAGTAACCAAGATCCATAATGGCTCAGTGTTTACCAAGAATCTGTGCAGTCAGATGTCGGCAGTCAGC
  GGGCCTCTCCTACAGTGGTTGGAGGACAGACTGGAGCAAAACCAACAGCATTTGCAGGAATTACAACAAG
  AAAAGGAAGAGCTTATGCAAGAACTTTCTTCTCTAGAATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_024332
• ORF Size: 951 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_024332.3, NP_077308.1
• RefSeq Size: 2952
• RefSeq ORF: 951
• Locus ID: 79184
• Domains: JAB_MPN
• Protein Families: Druggable Genome, Protease
• Gene Summary: This gene encodes a subunit of the BRCA1-BRCA2-containing complex (BRCC), which is an E3 ubiquitin ligase. This complex plays a role in the DNA damage response, where it is responsible for the stable accumulation of BRCA1 at DNA break sites. The component encoded by this gene can specifically cleave Lys 63-linked polyubiquitin chains, and it regulates the abundance of these polyubiquitin chains in chromatin. The loss of this gene results in abnormal angiogenesis and is associated with syndromic moyamoya, a cerebrovascular angiopathy. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 5. [provided by RefSeq, Jun 2011]
  Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).