QPRT (NM_014298) Human Untagged Clone

CAT#: SC310560

QPRT (untagged)-Human quinolinate phosphoribosyltransferase (QPRT)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: QPRT
• Synonyms: HEL-S-90n; QPRTase
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_014298, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGACGCTGAAGGCCTGGCGCTGCTGCTGCCGCCCGTCACCCTGGCAGCCCTGGTGGACAGCTGGCTCC
  GAGAGGACTGCCCAGGGCTCAACTACGCAGCCTTGGTCAGCGGGGCAGGCCCCTCGCAGGCGGCGCTGTG
  GGCCAAATCCCCTGGGGTACTGGCAGGGCAGCCTTTCTTCGATGCCATATTTACCCAACTCAACTGCCAA
  GTCTCCTGGTTCCTCCCCGAGGGATCGAAGCTGGTGCCGGTGGCCAGAGTGGCCGAGGTCCGGGGCCCTG
  CCCACTGCCTGCTGCTGGGGGAACGGGTGGCCCTCAACACGCTGGCCCGCTGCAGTGGCATTGCCAGTGC
  TGCCGCCGCTGCAGTGGAGGCCGCCAGGGGGGCCGGCTGGACTGGGCACGTGGCAGGCACGAGGAAGACC
  ACGCCAGGCTTCCGGCTGGTGGAGAAGTATGGGCTCCTGGTGGGCGGGGCCGCCTCGCACCGCTACGACC
  TGGGAGGGCTGGTGATGGTGAAGGATAACCATGTGGTGGCCGCCGGTGGCGTGGAGAAGGCGGTGCGGGC
  GGCCAGACAGGCGGCTGACTTCGCTCTGAAGGTGGAAGTGGAATGCAGCAGCCTGCAGGAGGCCGTGCAG
  GCAGCTGAGGCTGGTGCCGACCTTGTCCTGCTGGACAACTTCAAGCCAGAGGAGCTGCACCCCACGGCCA
  CCGTGCTGAAGGCCCAGTTCCCGAGTGTGGCTGTGGAAGCCAGTGGGGGCATCACCCTGGACAACCTCCC
  CCAGTTCTGCGGGCCGCACATAGACGTCATCTCCATGGGGATGCTGACCCAGGCGGCCCCAGCCCTTGAT
  TTCTCCCTCAAGCTGTTTGCCAAAGAGGTGGCTCCAGTGCCCAAAATCCACTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_014298
• ORF Size: 894 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_014298.4, NP_055113.2
• RefSeq Size: 2385
• RefSeq ORF: 894
• Locus ID: 23475
• Domains: QRPTase
• Protein Pathways: Metabolic pathways, Nicotinate and nicotinamide metabolism
• Gene Summary: This gene encodes a key enzyme in catabolism of quinolinate, an intermediate in the tryptophan-nicotinamide adenine dinucleotide pathway. Quinolinate acts as a most potent endogenous exitotoxin to neurons. Elevation of quinolinate levels in the brain has been linked to the pathogenesis of neurodegenerative disorders such as epilepsy, Alzheimer's disease, and Huntington's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
  Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).