FBXO17 (NM_148169) Human Untagged Clone

CAT#: SC310570

FBXO17 (untagged)-Human F-box protein 17 (FBXO17), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: FBXO17
• Synonyms: FBG4; Fbx17; FBX26; FBXO26
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_148169, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAGCAAGGACTCTGGCTACTGGAGATGGGCGCCCGGCTATCGCGGCGACGGCTGCCGGCGGACCCAT
  CCCTGGCCCTGGACGCGCTGCCCCCGGAGCTGCTGGTGCAGGTGCTGAGCCACGTGCCGCCACGCTCCTT
  GGTCACGCGATGCCGCCCAGTGTGCCGCGCCTGGCGCGACATAGTGGACGGGCCCACTGTGTGGCTGCTG
  CAGCTGGCCCGCGACCGCAGCGCCGAGGGCCGCGCACTCTACGCAGTGGCTCAACGCTGCCTGCCCAGCA
  ACGAAGACAAGGAGGAGTTCCCGCTGTGCGCCCTGGCGCGCTACTGTCTGCGCGCGCCCTTCGGCCGCAA
  TCTCATCTTCAACTCCTGCGGAGAGCAGGGCTTCAGAGGCTGGGAGGTGGAGCATGGCGGGAACGGCTGG
  GCCATAGAAAAGAACCTAACACCGGTGCCTGGGGCTCCTTCGCAGACCTGCTTCGTGACCTCTTTCGAAT
  GGTGCTCCAAGAGGCAGCTTGTGGACCTGGTGATGGAAGGGGTGTGGCAGGAGCTGCTGGACAGCGCCCA
  GATTGAGATCTGTGTGGCTGACTGGTGGGGCGCTCGAGAGAACTGCGGCTGCGTCTACCAGCTCCGGGTC
  CGCCTTCTGGATGTGTATGAAAAGGAAGTGGTCAAGTTCTCAGCCTCACCTGACCCGGTCCTTCAGTGGA
  CTGAGAGGGGCTGCCGACAGGTCTCCCACGTCTTCACCAACTTTGGCAAGGGCATCCGCTACGTATCTTT
  TGAGCAGTACGGGAGAGACGTGAGTTCCTGGGTGGGGCACTATGGCGCCCTTGTGACCCACTCCAGTGTG
  AGGGTCAGGATCCGTCTGTCCTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_148169
• ORF Size: 864 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_148169.2, NP_680474.1
• RefSeq Size: 2183
• RefSeq ORF: 864
• Locus ID: 115290
• Domains: F-box, FBA
• Protein Families: Druggable Genome
• Gene Summary: This gene encodes a member of the F-box protein family which is characterized by the F-box motif. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class and it contains an F-box domain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
  Transcript Variant: This variant (1) contains an alternate 5' terminal exon and initiates translation at an alternate start codon, compared to variant 2. It encodes isoform 1, which has a longer N-terminus, compared to isoform 2.