HAAO (NM_012205) Human Untagged Clone

CAT#: SC310572

HAAO (untagged)-Human 3-hydroxyanthranilate 3,4-dioxygenase (HAAO)


  "NM_012205" in other vectors (6)

Reconstitution Protocol

USD 660.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "HAAO"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HAAO
Synonyms 3-HAO; h3HAO; HAO; VCRL1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_012205, the custom clone sequence may differ by one or more nucleotides


ATGGAGCGCCGCCTGGGAGTGAGGGCCTGGGTGAAGGAGAACCGGGGCTCCTTCCAGCCCCCGGTCTGCA
ACAAGCTCATGCACCAGGAGCAGCTCAAAGTCATGTTCATCGGAGGCCCCAACACCAGGAAGGACTATCA
CATCGAAGAGGGTGAAGAGGTATTTTACCAGCTGGAGGGAGACATGGTTCTCCGAGTCCTGGAGCAAGGG
AAACACCGGGATGTGGTCATTCGGCAGGGAGAGATATTCCTCCTGCCTGCCAGGGTGCCCCACTCACCAC
AGAGGTTTGCCAACACCGTGGGGCTGGTGGTTGAGCGAAGGCGGCTGGAGACCGAGCTAGATGGGCTCAG
GTACTATGTGGGCGACACCATGGACGTTCTGTTTGAGAAGTGGTTCTACTGCAAGGACCTCGGCACGCAG
TTGGCCCCCATCATCCAGGAGTTCTTCAGCTCTGAGCAGTACAGAACAGGAAAGCCCATCCCTGACCAGC
TGCTCAAGGAGCCACCATTCCCTCTGAGCACACGATCCATCATGGAGCCCATGTCCCTGGATGCCTGGCT
GGACAGCCACCACAGGGAGCTGCAGGCAGGCACACCACTCAGCCTGTTTGGGGACACCTATGAGACCCAG
GTGATCGCCTATGGGCAAGGCAGCAGCGAAGGCCTGAGACAGAATGTGGACGTGTGGCTGTGGCAGCTGG
AGGGCTCCTCGGTGGTGACAATGGGGGGACGGCGCCTGAGCCTGGCCCCTGATGACAGCCTCCTGGTGCT
AGCTGGGACCTCGTATGCCTGGGAGCGAACACAAGGCTCTGTGGCCCTGTCTGTGACCCAGGACCCTGCC
TGCAAGAAGCCCCTGGGGTGA


Restriction Sites SgfI-MluI     
ACCN NM_012205
ORF Size 861 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_012205.2, NP_036337.2
RefSeq Size 1301
RefSeq ORF 861
Locus ID 23498
Protein Pathways Metabolic pathways, Tryptophan metabolism
Gene Summary 3-Hydroxyanthranilate 3,4-dioxygenase is a monomeric cytosolic protein belonging to the family of intramolecular dioxygenases containing nonheme ferrous iron. It is widely distributed in peripheral organs, such as liver and kidney, and is also present in low amounts in the central nervous system. HAAO catalyzes the synthesis of quinolinic acid (QUIN) from 3-hydroxyanthranilic acid. QUIN is an excitotoxin whose toxicity is mediated by its ability to activate glutamate N-methyl-D-aspartate receptors. Increased cerebral levels of QUIN may participate in the pathogenesis of neurologic and inflammatory disorders. HAAO has been suggested to play a role in disorders associated with altered tissue levels of QUIN. [provided by RefSeq, Jul 2008]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.