HAAO (NM_012205) Human Untagged Clone
CAT#: SC310572
HAAO (untagged)-Human 3-hydroxyanthranilate 3,4-dioxygenase (HAAO)
"NM_012205" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | HAAO |
Synonyms | 3-HAO; h3HAO; HAO; VCRL1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_012205, the custom clone sequence may differ by one or more nucleotides
ATGGAGCGCCGCCTGGGAGTGAGGGCCTGGGTGAAGGAGAACCGGGGCTCCTTCCAGCCCCCGGTCTGCA ACAAGCTCATGCACCAGGAGCAGCTCAAAGTCATGTTCATCGGAGGCCCCAACACCAGGAAGGACTATCA CATCGAAGAGGGTGAAGAGGTATTTTACCAGCTGGAGGGAGACATGGTTCTCCGAGTCCTGGAGCAAGGG AAACACCGGGATGTGGTCATTCGGCAGGGAGAGATATTCCTCCTGCCTGCCAGGGTGCCCCACTCACCAC AGAGGTTTGCCAACACCGTGGGGCTGGTGGTTGAGCGAAGGCGGCTGGAGACCGAGCTAGATGGGCTCAG GTACTATGTGGGCGACACCATGGACGTTCTGTTTGAGAAGTGGTTCTACTGCAAGGACCTCGGCACGCAG TTGGCCCCCATCATCCAGGAGTTCTTCAGCTCTGAGCAGTACAGAACAGGAAAGCCCATCCCTGACCAGC TGCTCAAGGAGCCACCATTCCCTCTGAGCACACGATCCATCATGGAGCCCATGTCCCTGGATGCCTGGCT GGACAGCCACCACAGGGAGCTGCAGGCAGGCACACCACTCAGCCTGTTTGGGGACACCTATGAGACCCAG GTGATCGCCTATGGGCAAGGCAGCAGCGAAGGCCTGAGACAGAATGTGGACGTGTGGCTGTGGCAGCTGG AGGGCTCCTCGGTGGTGACAATGGGGGGACGGCGCCTGAGCCTGGCCCCTGATGACAGCCTCCTGGTGCT AGCTGGGACCTCGTATGCCTGGGAGCGAACACAAGGCTCTGTGGCCCTGTCTGTGACCCAGGACCCTGCC TGCAAGAAGCCCCTGGGGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_012205 |
ORF Size | 861 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_012205.2, NP_036337.2 |
RefSeq Size | 1301 |
RefSeq ORF | 861 |
Locus ID | 23498 |
Protein Pathways | Metabolic pathways, Tryptophan metabolism |
Gene Summary | 3-Hydroxyanthranilate 3,4-dioxygenase is a monomeric cytosolic protein belonging to the family of intramolecular dioxygenases containing nonheme ferrous iron. It is widely distributed in peripheral organs, such as liver and kidney, and is also present in low amounts in the central nervous system. HAAO catalyzes the synthesis of quinolinic acid (QUIN) from 3-hydroxyanthranilic acid. QUIN is an excitotoxin whose toxicity is mediated by its ability to activate glutamate N-methyl-D-aspartate receptors. Increased cerebral levels of QUIN may participate in the pathogenesis of neurologic and inflammatory disorders. HAAO has been suggested to play a role in disorders associated with altered tissue levels of QUIN. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC206273 | HAAO (Myc-DDK-tagged)-Human 3-hydroxyanthranilate 3,4-dioxygenase (HAAO) |
USD 420.00 |
|
RG206273 | HAAO (GFP-tagged) - Human 3-hydroxyanthranilate 3,4-dioxygenase (HAAO) |
USD 460.00 |
|
RC206273L1 | Lenti ORF clone of Human 3-hydroxyanthranilate 3,4-dioxygenase (HAAO), Myc-DDK-tagged |
USD 620.00 |
|
RC206273L2 | Lenti ORF clone of Human 3-hydroxyanthranilate 3,4-dioxygenase (HAAO), mGFP tagged |
USD 620.00 |
|
RC206273L3 | Lenti ORF clone of Human 3-hydroxyanthranilate 3,4-dioxygenase (HAAO), Myc-DDK-tagged |
USD 620.00 |
|
RC206273L4 | Lenti ORF clone of Human 3-hydroxyanthranilate 3,4-dioxygenase (HAAO), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review