RFXAP (NM_000538) Human Untagged Clone

CAT#: SC310582

RFXAP (untagged)-Human regulatory factor X-associated protein (RFXAP)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RFXAP
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_000538, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAGGCGCAGGGTGTAGCGGAGGGCGCGGGGCCGGGCGCCGCCAGCGGCGTGCCCCACCCCGCGGCCC
  TAGCCCCGGCTGCGGCTCCCACCTTGGCGCCAGCCTCGGTGGCGGCCGCGGCCTCTCAATTCACCCTGCT
  AGTGATGCAACCCTGTGCTGGGCAGGACGAGGCTGCGGCCCCCGGGGGCAGCGTTGGGGCGGGCAAGCCC
  GTTAGGTACCTGTGCGAAGGGGCCGGGGATGGCGAAGAGGAGGCTGGGGAGGACGAGGCGGACCTGTTAG
  ACACTTCGGACCCTCCGGGGGGAGGCGAGAGCGCGGCTAGTTTGGAGGATCTAGAGGACGAGGAGACTCA
  CTCGGGGGGCGAGGGCAGCAGCGGGGGCGCCCGGAGGCGGGGCAGCGGTGGGGGCAGCATGAGCAAGACC
  TGCACCTACGAAGGCTGCAGCGAGACCACGAGCCAGGTGGCCAAGCAGCGCAAACCGTGGATGTGCAAGA
  AACACCGCAACAAGATGTACAAGGACAAGTATAAAAAGAAGAAGAGCGACCAGGCCCTGAACTGCGGTGG
  GACTGCCTCGACTGGCAGCGCGGGAAACGTCAAACTCGAGGAAAGTGCAGATAACATACTCTCCATTGTT
  AAACAAAGAACAGGATCTTTTGGGGATCGTCCTGCAAGACCTACTCTTTTAGAACAAGTGTTAAATCAAA
  AAAGACTGTCGTTACTAAGAAGTCCAGAAGTAGTGCAATTTTTACAGAAACAGCAACAGCTATTAAATCA
  GCAAGTTTTGGAGCAAAGACAACAGCAGTTTCCAGGAACATCAATGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_000538
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_000538.3, NP_000529.1
• RefSeq Size: 2825 bp
• RefSeq ORF: 819 bp
• Locus ID: 5994
• Cytogenetics: 13q13.3
• Protein Families: Transcription Factors
• Protein Pathways: Antigen processing and presentation, Primary immunodeficiency
• Gene Summary: 'Major histocompatibility (MHC) class II molecules are transmembrane proteins that have a central role in development and control of the immune system. The protein encoded by this gene, along with regulatory factor X-associated ankyrin-containing protein and regulatory factor-5, forms a complex that binds to the X box motif of certain MHC class II gene promoters and activates their transcription. Once bound to the promoter, this complex associates with the non-DNA-binding factor MHC class II transactivator, which controls the cell type specificity and inducibility of MHC class II gene expression. Mutations in this gene have been linked to bare lymphocyte syndrome type II, complementation group D. Transcript variants utilizing different polyA signals have been found for this gene. [provided by RefSeq, Jul 2008]'