UBE2J2 (NM_058167) Human Untagged Clone

CAT#: SC310589

UBE2J2 (untagged)-Human ubiquitin-conjugating enzyme E2, J2 (UBE2J2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: UBE2J2
• Synonyms: NCUBE-2; NCUBE2; PRO2121
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_058167, the custom clone sequence may differ by one or more nucleotides
  ATGAGCAGCACCAGCAGTAAGAGGGCTCCGACCACGGCAACCCAGAGGCTGAAGCAGGAC
  TACCTTCGCATTAAGAAAGACCCGGTGCCTTACATCTGTGCCGAGCCCCTCCCTTCGAAT
  ATTCTCGAGTGGCACTATGTCGTCCGAGGCCCAGAGATGACCCCTTATGAAGGTGGCTAT
  TATCATGGAAAACTAATTTTTCCCAGAGAATTTCCTTTCAAACCTCCCAGTATCTATATG
  ATCACTCCCAACGGGAGGTTTAAGTGCAACACCAGGCTGTGTCTTTCTATCACGGATTTC
  CACCCGGACACGTGGAACCCGGCCTGGTCTGTCTCCACCATCCTGACTGGGCTCCTGAGC
  TTCATGGTGGAGAAGGGCCCCACCCTGGGCAGTATAGAGACGTCGGACTTCACGAAAAGA
  CAACTGGCAGTGCAGAGTTTAGCATTTAATTTGAAAGATAAAGTCTTTTGTGAATTATTT
  CCTGAAGTCGTGGAGGAGATTAAACAAAAACAGAAAGCACAAGACGAACTCAGTAGCAGA
  CCCCAGACTCTCCCCTTGCCAGACGTGGTTCCAGACGGGGAGACGCACCTCGTCCAGAAC
  GGGATTCAGCTGCTCAACGGGCATGCGCCGGGGGCCGTCCCAAACCTCGCAGGGCTCCAG
  CAGGCCAACCGGCACCACGGACTCCTGGGTGGCGCCCTGGCGAACTTGTTTGTGATAGTT
  GGGTTTGCAGCCTTTGCTTACACGGTCAAGTACGTGCTGAGGAGCATCGCGCAGGAGTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_058167
• ORF Size: 780 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_058167.2, NP_477515.2
• RefSeq Size: 2267
• RefSeq ORF: 780
• Locus ID: 118424
• Domains: UBCc
• Protein Families: Transmembrane
• Protein Pathways: Parkinson's disease, Ubiquitin mediated proteolysis
• Gene Summary: The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme is located in the membrane of the endoplasmic reticulum. Multiple alternatively spliced transcript variants have been found for this gene, but the full-length nature of some variants has not been defined. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) lacks an in-frame internal exon, as compared to variant 1. The encoded isoform (2) is thus missing an internal segment, as compared to isoform 1.