Bcl G (BCL2L14) (NM_030766) Human Untagged Clone
CAT#: SC310598
BCL2L14 (untagged)-Human BCL2-like 14 (apoptosis facilitator) (BCL2L14), transcript variant 2
"NM_030766" in other vectors (6)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | BCL2L14 |
Synonyms | BCLG |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_030766, the custom clone sequence may differ by one or more nucleotides
ATGTGTAGCACCAGTGGGTGTGACCTGGAAGAAATCCCCCTAGATGATGATGACCTAAACACCATAGAAT TCAAAATCCTCGCCTACTACACCAGACATCATGTCTTCAAGAGCACCCCTGCTCTCTTCTCACCAAAGCT GCTGAGAACAAGAAGTTTGTCCCAGAGGGGCCTGGGGAATTGTTCAGCAAATGAGTCATGGACAGAGGTG TCATGGCCTTGCAGAAATTCCCAATCCAGTGAGAAGGCCATAAACCTTGGCAAGAAAAAGTCTTCTTGGA AAGCATTCTTTGGAGTAGTGGAGAAGGAAGATTCGCAGAGCACGCCTGCCAAGGTCTCTGCTCAGGGTCA AAGGACGTTGGAATACCAAGATTCGCACAGCCAGCAGTGGTCCAGGTGTCTTTCTAACGTGGAGCAGTGC TTGGAGCATGAAGCTGTGGACCCCAAAGTCATTTCCATTGCCAACCGAGTAGCTGAAATTGTTTACTCCT GGCCACCACCACAAGCGACCCAGGCAGGAGGCTTCAAGTCCAAAGAGATTTTTGTAACTGAGGGTCTCTC CTTCCAGCTCCAAGGCCACGTGCCTGTAGCTTCAAGTTCTAAGAAAGATGAAGAAGAACAAATACTAGCC AAAATTGTTGAGCTGCTGAAATATTCAGGAGATCAGTTGGAAAGAAAGGACACTGCCTTCATCCCCATTC CCTTGGTTGACACCAGCATCCAGGGTTTTCCACAGGATGGTTTGATGGCCTGCATTTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_030766 |
ORF Size | 759 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_030766.1, NP_110393.1 |
RefSeq Size | 2039 |
RefSeq ORF | 759 |
Locus ID | 79370 |
Protein Families | Druggable Genome |
Gene Summary | The protein encoded by this gene belongs to the BCL2 protein family. BCL2 family members form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. Overexpression of this gene has been shown to induce apoptosis in cells. Three alternatively spliced transcript variants encoding two distinct isoforms have been reported for this gene. [provided by RefSeq, May 2009] Transcript Variant: This variant (2) is also known as BCL-G short form. It contains an extra segment within the coding region, which results in a frameshift, when compared to variant 1. This variant encodes an isoform (2) that contains a shorter and distinct C terminus, as compared to isoform 1. CCDS Note: This CCDS ID is based on AF281255.1. This transcript appears to be a nonsense-mediated mRNA decay (NMD) candidate; however, there are publications describing this transcript and its encoded protein (Guo et al, 2001, PMID 11054413; Liu et al, 2008, PMID 18006276) so this CCDS ID has been retained. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215114 | BCL2L14 (Myc-DDK-tagged)-Human BCL2-like 14 (apoptosis facilitator) (BCL2L14), transcript variant 2 |
USD 98.00 |
|
RG215114 | BCL2L14 (GFP-tagged) - Human BCL2-like 14 (apoptosis facilitator) (BCL2L14), transcript variant 2 |
USD 460.00 |
|
RC215114L1 | Lenti ORF clone of Human BCL2-like 14 (apoptosis facilitator) (BCL2L14), transcript variant 2, Myc-DDK-tagged |
USD 768.00 |
|
RC215114L2 | Lenti ORF clone of Human BCL2-like 14 (apoptosis facilitator) (BCL2L14), transcript variant 2, mGFP tagged |
USD 620.00 |
|
RC215114L3 | Lenti ORF clone of Human BCL2-like 14 (apoptosis facilitator) (BCL2L14), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC215114L4 | Lenti ORF clone of Human BCL2-like 14 (apoptosis facilitator) (BCL2L14), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review