KCTD5 (NM_018992) Human Untagged Clone
CAT#: SC310612
KCTD5 (untagged)-Human potassium channel tetramerisation domain containing 5 (KCTD5)
"NM_018992" in other vectors (7)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | KCTD5 |
Synonyms | FLJ20040 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_018992, the custom clone sequence may differ by one or more nucleotides
ATGGCGGAGAATCACTGCGAGCTCCTGTCGCCGGCCCGGGGCGGCATCGGGGCGGGGCTGGGGGGCGGCC TGTGCCGCCGCTGCAGCGCTGGGCTCGGCGCCCTGGCCCAGCGCCCTGGCAGCGTGTCCAAGTGGGTCCG ACTCAACGTCGGCGGCACCTACTTCCTCACCACTCGGCAGACCCTGTGCCGGGACCCGAAATCCTTCCTG TACCGCTTATGCCAGGCCGATCCCGACCTGGACTCAGACAAGGATGAAACAGGCGCCTATTTAATCGACA GAGACCCCACCTACTTTGGGCCTGTGCTGAACTACCTGAGACACGGCAAGCTGGTGATTAACAAAGACCT CGCGGAGGAAGGAGTGTTGGAGGAAGCAGAATTTTACAATATCACCTCATTAATAAAACTTGTAAAGGAC AAAATTAGAGAACGAGACAGCAAAACATCGCAGGTGCCTGTGAAGCATGTGTACCGTGTGCTGCAGTGCC AGGAGGAGGAGCTCACGCAGATGGTGTCCACCATGTCCGACGGCTGGAAGTTCGAGCAGTTGGTCAGCAT CGGCTCCTCTTACAACTATGGGAACGAAGACCAAGCCGAGTTCCTCTGTGTGGTGTCCAAGGAGCTGCAC AACACCCCGTACGGTACGGCCAGCGAGCCCAGCGAGAAGGCCAAGATTTTGCAAGAACGAGGCTCAAGGA TGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_018992 |
ORF Size | 705 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_018992.3, NP_061865.1 |
RefSeq Size | 2479 |
RefSeq ORF | 705 |
Locus ID | 54442 |
Domains | BTB, K_tetra |
Protein Families | Ion Channels: Other |
Gene Summary | Its interaction with CUL3 suggests that it may act as a substrate adapter in some E3 ligase complex. Does not affect the function of Kv channel Kv2.1/KCNB1, Kv1.2/KCNA2, Kv4.2/KCND2 and Kv3.4/KCNC4. [UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC320723 | KCTD5 (untagged)-Human potassium channel tetramerisation domain containing 5 (KCTD5) |
USD 420.00 |
|
RC200180 | KCTD5 (Myc-DDK-tagged)-Human potassium channel tetramerisation domain containing 5 (KCTD5) |
USD 98.00 |
|
RG200180 | KCTD5 (GFP-tagged) - Human potassium channel tetramerisation domain containing 5 (KCTD5) |
USD 460.00 |
|
RC200180L1 | Lenti ORF clone of Human potassium channel tetramerisation domain containing 5 (KCTD5), Myc-DDK-tagged |
USD 768.00 |
|
RC200180L2 | Lenti ORF clone of Human potassium channel tetramerisation domain containing 5 (KCTD5), mGFP tagged |
USD 768.00 |
|
RC200180L3 | Lenti ORF clone of Human potassium channel tetramerisation domain containing 5 (KCTD5), Myc-DDK-tagged |
USD 768.00 |
|
RC200180L4 | Lenti ORF clone of Human potassium channel tetramerisation domain containing 5 (KCTD5), mGFP tagged |
USD 768.00 |
{0} Product Review(s)
Be the first one to submit a review