CATSPER2 (NM_172097) Human Untagged Clone

CAT#: SC310631

CATSPER2 (untagged)-Human cation channel, sperm associated 2 (CATSPER2), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CATSPER2
• Synonyms: MGC33346
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_172097, the custom clone sequence may differ by one or more nucleotides
  ATGGCCGCTTACCAACAAGAAGAGCAGATGCAGCTTCCCCGAGCTGATGCCATTCGTTCA
  CGTCTCATCGATACTTTCTCTCTCATTGAGCATTTGCAAGGCTTGAGCCAAGCTGTGCCG
  CGGCACACTATCAGGGAGTTACTTGATCCTTCCCGCCAGAAGAAACTTGTATTGGGAGAT
  CAACACCAGCTAGTGCGTTTCTCTATAAAGCCTCAGCGTATAGAACAGATTTCACATGCC
  CAGAGGCTGTTGAGCAGGCTTCATGTGCGCTGCAGTCAGAGGCCACCTCTTTCTTTGTGG
  GCCGGATGGGTCCTTGAGTGTCCTCTCTTCAAAAACTTCATCATCTTCCTGGTCTTTTTG
  AATACGATCATATTGATGGTTGAAATAGAATTGCTGGAATCCACAAATACCAAACTATGG
  CCATTGAAGCTGACCTTGGAGGTGGCAGCTTGGTTTATCTTGCTTATTTTCATCCTGGAG
  ATCCTTCTTAAGTGGCTATCCAACTTTTCTGTTTTCTGGAAGAGTGCCTGGAATGTCTTT
  GACTTTGTTGTTACCATGTTGGTAAGGATAGAGATCCTGAGGGTTCGTTTAGTGGGATGA
  
• Restriction Sites: Please inquire
• ACCN: NM_172097
• ORF Size: 600 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_172097.1, NP_742095.1
• RefSeq Size: 1678
• RefSeq ORF: 600
• Locus ID: 117155
• Protein Families: Druggable Genome, Ion Channels: Other, Transmembrane
• Gene Summary: This gene encodes a member of a family of cation channel proteins that localize to the flagellum of spermatozoa. Defects at this locus causes male infertility. Alternatively spliced transcript variants have been observed at this locus. Readthrough transcription originates upstream of this locus in diphosphoinositol pentakisphosphate kinase 1 pseudogene 1 and is represented by GeneID:110006325. Related pseudogenes are found next to this locus on chromosome 15 and on chromosome 5. [provided by RefSeq, Mar 2017]
  Transcript Variant: This variant (4) differs in both UTR's and the coding region but maintains the reading frame, compared to variant 5. This results in a protein that is shorter at both the N- and C-termini, compared to isoform 5.