RBPMS (NM_006867) Human Untagged Clone

CAT#: SC310634

RBPMS (untagged)-Human RNA binding protein with multiple splicing (RBPMS), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RBPMS
• Synonyms: HERMES
• Vector: pCMV6-XL4
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_006867 edited
  CGCCCGAGGGAGCCCCGGCGCCCGGGGAAGGCTCCAGTGGGCTAGCGCGCCCTCGCCCAG
  CCCCGCGCCCCAGCCCTGCCCGGCCCGGCGAGGAAGGACCGGGAAGATGAACAACGGCGG
  CAAAGCCGAGAAGGAGAACACCCCGAGCGAGGCCAACCTTCAGGAGGAGGAGGTCCGGAC
  CCTATTTGTCAGTGGCCTTCCTCTGGATATCAAACCTCGGGAGCTCTATCTGCTTTTCAG
  ACCATTTAAGGGCTATGAGGGTTCTCTTATAAAGCTCACATCTAAACAGCCTGTAGGTTT
  TGTCAGTTTTGACAGTCGCTCAGAAGCAGAGGCTGCAAAGAATGCTTTGAATGGCATCCG
  CTTCGATCCTGAAATTCCGCAAACACTACGACTAGAGTTTGCTAAGGCAAACACGAAGAT
  GGCCAAGAACAAACTCGTAGGGACTCCAAACCCCAGTACTCCTCTGCCCAACACTGTACC
  TCAGTTCATTGCCAGAGAGCCATATGAGCTCACAGTGCCTGCACTTTACCCCAGTAGCCC
  TGAAGTGTGGGCCCCGTACCCTCTGTACCCAGCGGAGTTAGCGCCTGCTCTACCTCCTCC
  TGCTTTCACCTATCCCGCTTCACTGCATGCCCAGATGCGCTGGCTCCCTCCCTCCGAGGC
  TACTTCTCAGGGCTGGAAGTCCCGTCAGTTCTGCTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_006867
• ORF Size: 591 bp
• Insert Size: 800
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_006867.2, NP_006858.1
• RefSeq Size: 3154
• RefSeq ORF: 591
• Locus ID: 11030
• Domains: RRM
• Protein Families: Stem cell - Pluripotency
• Gene Summary: This gene encodes a member of the RNA recognition motif family of RNA-binding proteins. The RNA recognition motif is between 80-100 amino acids in length and family members contain one to four copies of the motif. The RNA recognition motif consists of two short stretches of conserved sequence, as well as a few highly conserved hydrophobic residues. The encoded protein has a single, putative RNA recognition motif in its N-terminus. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2013]
  Transcript Variant: This variant (4) includes an alternate exon in the 3' UTR compared to variant 1. Variants 1 and 4 encode the same isoform (A).