OTUD4 (NM_017493) Human Untagged Clone

CAT#: SC310667

OTUD4 (untagged)-Human OTU domain containing 4 (OTUD4), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: OTUD4
• Synonyms: DUBA6; HIN1; HSHIN1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_017493, the custom clone sequence may differ by one or more nucleotides
  ATGGCCTGTATTCACTATCTTCGAGAGAACAGAGAGAAATTTGAAGCGTTTATAGAAGGA
  TCATTTGAAGAATATTTAAAGCGTTTGGAAAATCCACAGGAATGGGTAGGACAAGTGGAA
  ATAAGTGCCCTTTCTCTTATGTACAGGAAAGATTTTATAATTTATCGGGAACCAAATGTT
  TCTCCTTCACAAGTAACAGAAAATAATTTTCCTGAAAAGGTGTTACTGTGTTTTTCAAAT
  GGAAATCATTATGATATTGTGTATCCCATAAAGTATAAAGAAAGCTCTGCTATGTGTCAG
  TCTCTCCTTTATGAATTGCTGTATGAGAAGGTATTTAAAACTGATGTTAGTAAAATTGTG
  ATGGAACTAGACACGTTGGAAGTAGCTGATGAAGATAACAGTGAAATATCAGATTCAGAG
  GATGACAGTTGCAAGTAA
  
• Restriction Sites: Please inquire
• ACCN: NM_017493
• ORF Size: 846 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_017493.4, NP_059963.1
• RefSeq Size: 864
• RefSeq ORF: 846
• Locus ID: 54726
• Domains: OTU
• Gene Summary: Alternatively spliced transcript variants have been found for this gene. The smaller protein isoform encoded by the shorter transcript variant is found only in HIV-1 infected cells. [provided by RefSeq, Jul 2010]
  Transcript Variant: This variant (2) differs in the 3' UTR and coding region compared to variant 3. The resulting isoform (2) is much shorter at the C-terminus compared to isoform 3.