C1D (NM_173177) Human Untagged Clone
CAT#: SC310671
C1D (untagged)-Human C1D nuclear receptor corepressor (C1D), transcript variant 2
"NM_173177" in other vectors (5)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | C1D |
Synonyms | hC1D; LRP1; Rrp47; SUN-CoR; SUNCOR |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_173177, the custom clone sequence may differ by one or more nucleotides
ATGGCAGGTGAAGAAATTAATGAAGACTATCCAGTAGAAATTCACGAGTATTTGTCAGCGTTTGAGAATT CCATTGGTGCTGTGGATGAGATGCTGAAGACCATGATGTCTGTTTCTAGAAATGAGTTGTTGCAGAAGTT GGATCCACTTGAACAAGCAAAAGTGGATTTGGTTTCTGCATACACATTAAATTCAATGTTTTGGGTTTAT TTGGCAACCCAAGGAGTTAATCCTAAGGAACATCCAGTAAAACAGGAATTGGAAAGAATCAGAGTATATA TGAACAGAGTCAAGGAAATAACAGACAAGAAAAAGGCTGGCAAGCTGGACAGAGGTGCAGCTTCAAGATT TGTAAAAAATGCCCTCTGGGAACCAAAATCGAAAAATGCATCAAAAGTTGCCAATAAAGGAAAAAGTAAA AGTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_173177 |
ORF Size | 426 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_173177.2, NP_775269.1 |
RefSeq Size | 1194 |
RefSeq ORF | 426 |
Locus ID | 10438 |
Protein Families | Druggable Genome |
Protein Pathways | RNA degradation |
Gene Summary | The protein encoded by this gene is a DNA binding and apoptosis-inducing protein and is localized in the nucleus. It is also a Rac3-interacting protein which acts as a corepressor for the thyroid hormone receptor. This protein is thought to regulate TRAX/Translin complex formation. Alternate splicing results in multiple transcript variants that encode the same protein. Multiple pseudogenes of this gene are found on chromosome 10. [provided by RefSeq, Jun 2010] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1, 2, 3 and 4 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC321081 | C1D (untagged)-Human C1D nuclear receptor corepressor (C1D), transcript variant 2 |
USD 420.00 |
|
RC203301 | C1D (Myc-DDK-tagged)-Human C1D nuclear receptor corepressor (C1D), transcript variant 2 |
USD 98.00 |
|
RG203301 | C1D (GFP-tagged) - Human C1D nuclear receptor corepressor (C1D), transcript variant 2 |
USD 460.00 |
|
RC203301L3 | Lenti ORF clone of Human C1D nuclear receptor corepressor (C1D), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC203301L4 | Lenti ORF clone of Human C1D nuclear receptor corepressor (C1D), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review