DUSP10 (NM_144729) Human Untagged Clone

CAT#: SC310672

DUSP10 (untagged)-Human dual specificity phosphatase 10 (DUSP10), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DUSP10
• Synonyms: MKP-5; MKP5
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_144729, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCAGCGGCTGAACATCGGCTACGTCATCAACGTCACCACTCATCTTCCCCTCTACCACTATGAGAAAG
  GCCTGTTCAACTACAAGCGGCTGCCAGCCACTGACAGCAACAAGCAGAACCTGCGGCAGTACTTTGAAGA
  GGCTTTTGAGTTCATTGAGGAAGCTCACCAGTGTGGGAAGGGGCTTCTCATCCACTGCCAGGCTGGGGTG
  TCCCGCTCCGCCACCATCGTCATCGCTTACTTGATGAAGCACACTCGGATGACCATGACTGATGCTTATA
  AATTTGTCAAAGGCAAACGACCAATTATCTCCCCAAACCTTAACTTCATGGGGCAGTTGCTAGAGTTCGA
  GGAAGACCTAAACAACGGTGTGACACCGAGAATCCTTACACCAAAGCTGATGGGCGTGGAGACGGTTGTG
  TGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_144729
• ORF Size: 423 bp
• Insert Size: 423
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The ORF of this clone has been fully sequenced and found to be a perfect match to NM_144729.1.

Reference Data

• RefSeq: NM_144729.2, NP_653330.1
• RefSeq Size: 1824
• RefSeq ORF: 423
• Locus ID: 11221
• Domains: DSPc
• Protein Families: Druggable Genome, Phosphatase
• Protein Pathways: MAPK signaling pathway
• Gene Summary: Dual specificity protein phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the MAP kinase superfamily, which is associated with cellular proliferation and differentiation. Different members of this family of dual specificity phosphatases show distinct substrate specificities for MAP kinases, different tissue distribution and subcellular localization, and different modes of expression induction by extracellular stimuli. This gene product binds to and inactivates p38 and SAPK/JNK. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
  Transcript Variant: This variant (3) differs in the 5' UTR and coding region compared to variant 1, resulting in an isoform (b) that is shorter at the N-terminus compared to isoform a. Both variants 2 and 3 encode isoform b.