CD151 (NM_139029) Human Untagged Clone
CAT#: SC310704
CD151 (untagged)-Human CD151 molecule (Raph blood group) (CD151), transcript variant 4
"NM_139029" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CD151 |
Synonyms | GP27; MER2; PETA-3; RAPH; SFA1; TSPAN24 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_139029, the custom clone sequence may differ by one or more nucleotides
ATGGGTGAGTTCAACGAGAAGAAGACAACATGTGGCACCGTTTGCCTCAAGTACCTGCTGTTTACCTACA ATTGCTGCTTCTGGCTGGCTGGCCTGGCTGTCATGGCAGTGGGCATCTGGACGCTGGCCCTCAAGAGTGA CTACATCAGCCTGCTGGCCTCAGGCACCTACCTGGCCACAGCCTACATCCTGGTGGTGGCGGGCACTGTC GTCATGGTGACTGGGGTCTTGGGCTGCTGCGCCACCTTCAAGGAGCGTCGGAACCTGCTGCGCCTGTACT TCATCCTGCTCCTCATCATCTTTCTGCTGGAGATCATCGCTGGTATCCTCGCCTACGCCTACTACCAGCA GCTGAACACGGAGCTCAAGGAGAACCTGAAGGACACCATGACCAAGCGCTACCACCAGCCGGGCCATGAG GCTGTGACCAGCGCTGTGGACCAGCTGCAGCAGGAGTTCCACTGCTGTGGCAGCAACAACTCACAGGACT GGCGAGACAGTGAGTGGATCCGCTCACAGGAGGCCGGTGGCCGTGTGGTCCCAGACAGCTGCTGCAAGAC GGTGGTGGCTCTTTGTGGGCAGCGAGACCATGCCTCCAACATCTACAAGGTGGAGGGCGGCTGCATCACC AAGTTGGAGACCTTCATCCAGGAGCACCTGAGGGTCATTGGGGCTGTGGGGATCGGCATTGCCTGTGTGC AGGTCTTTGGCATGATCTTCACGTGCTGCCTGTACAGGAGTCTCAAGCTGGAGCACTACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_139029 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_139029.1, NP_620598.1 |
RefSeq Size | 1570 bp |
RefSeq ORF | 762 bp |
Locus ID | 977 |
Cytogenetics | 11p15.5 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | 'The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein that is known to complex with integrins and other transmembrane 4 superfamily proteins. It is involved in cellular processes including cell adhesion and may regulate integrin trafficking and/or function. This protein enhances cell motility, invasion and metastasis of cancer cells. Multiple alternatively spliced transcript variants that encode the same protein have been described for this gene. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (4) uses an alternate splice site in the 5' UTR, compared to variant 1. All variants encode the same protein. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219655 | CD151 (Myc-DDK-tagged)-Human CD151 molecule (Raph blood group) (CD151), transcript variant 4 |
USD 420.00 |
|
RG219655 | CD151 (GFP-tagged) - Human CD151 molecule (Raph blood group) (CD151), transcript variant 4 |
USD 460.00 |
|
RC219655L3 | Lenti ORF clone of Human CD151 molecule (Raph blood group) (CD151), transcript variant 4, Myc-DDK-tagged |
USD 620.00 |
|
RC219655L4 | Lenti ORF clone of Human CD151 molecule (Raph blood group) (CD151), transcript variant 4, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review