SPINK9 (NM_001040433) Human Untagged Clone

CAT#: SC310716

SPINK9 (untagged)-Human serine peptidase inhibitor, Kazal type 9 (SPINK9)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SPINK9
• Synonyms: LEKTI2
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001040433, the custom clone sequence may differ by one or more nucleotides
  ATGAGAGCAACAGCCATAGTCCTACTCTTGGCTCTGACACTTGCAACCATGTTCAGTATA
  GAATGTGCCAAACAGACGAAACAGATGGTTGACTGCAGTCATTATAAAAAGTTACCACCA
  GGACAACAGAGATTTTGTCATCATATGTATGATCCAATTTGTGGATCTGATGGCAAAACT
  TATAAAAATGATTGCTTCTTCTGTTCTAAAGTTAAGAAAACTGACGGCACACTTAAATTT
  GTACATTTTGGAAAATGTTAA
  
• Restriction Sites: Please inquire
• ACCN: NM_001040433
• ORF Size: 261 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001040433.1, NP_001035523.1
• RefSeq Size: 453
• RefSeq ORF: 261
• Locus ID: 643394
• Protein Families: Transmembrane
• Gene Summary: The protein encoded by this gene is a Kazal-type serine protease inhibitor that appears to specifically target kallikrein-related peptidase 5 (KLK5) in the palmo-plantar epidermis. KLK5 is an important initiator of skin desquamation, so the encoded protease inhibitor may regulate skin differentiation in the palms of hands and soles of feet. This cationic protein has also been shown to promote keratinocyte migration by activation of the epidermal growth factor receptor (EGFR). [provided by RefSeq, Dec 2015]