U2AF1L3 (U2AF1L4) (NM_001040425) Human Untagged Clone

CAT#: SC310723

U2AF1L4 (untagged)-Human U2 small nuclear RNA auxiliary factor 1-like 4 (U2AF1L4), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: U2AF1L4
• Synonyms: U2AF1-RS3; U2AF1L3; U2AF1L3V1; U2AF1RS3; U2af26
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001040425, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCTGAATATTTAGCTTCGATATTCGGGACTGAGAAGGACAAGGTTAACTGCTCTTTTTACTTTAAGA
  TCGGGGTCTGCCGGCACGGGGACCGGTGCTCCCGGCTTCACAACAAGCCGACATTCAGCCAGGAGGTGTT
  CACAGAACTGCAGGAGAAGTATGGGGAGATTGAAGAGATGAATGTGTGCGACAACCTTGGGGACCACCTC
  GTGGGCAACGTCTATGTCAAGTTCCGGAGGGAGGAGGATGGAGAGCGGGCCGTGGCTGAACTCAGTAACC
  GCTGGTTCAACGGGCAGGCTGTGCACGGTGAGCTGTCTCCTGTCACTGACTTCCGGGAGTCATGCTGTCG
  CCAGTATGAGATGGGGGAATGTACCCGAGGTGGCTTCTGCAACTTCATGCATCTGCGGCCCATTTCCCAG
  AACCTCCAGAGGCAGCTCTATGGGCGGGGACCCAGGCGCAGGTCACCCCCGAGGTTCCATACTGGCCACC
  ATCCCCGAGAGAGGAACCATCGGTGTTCCCCTGATCACTGGCATGGCCGCTTCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001040425
• ORF Size: 546 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001040425.2, NP_001035515.1
• RefSeq Size: 799
• RefSeq ORF: 546
• Locus ID: 199746
• Gene Summary: RNA-binding protein that function as a pre-mRNA splicing factor. Plays a critical role in both constitutive and enhancer-dependent splicing by mediating protein-protein interactions and protein-RNA interactions required for accurate 3'-splice site selection. Acts by enhancing the binding of U2AF2 to weak pyrimidine tracts. Also participates in the regulation of alternative pre-mRNA splicing. Activates exon 5 skipping of PTPRC during T-cell activation; an event reversed by GFI1. Binds to RNA at the AG dinucleotide at the 3'-splice site (By similarity). Shows a preference for AGC or AGA. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (1) has an alternate splice site in the coding region, which results in reading frameshift, compared to variant 2. The resulting isoform (1) is shorter and has a distinct C-terminus, compared to isoform 2.