DEDD (NM_001039712) Human Untagged Clone

CAT#: SC310813

DEDD (untagged)-Human death effector domain containing (DEDD), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DEDD
• Synonyms: CASP8IP1; DEDD1; DEFT; FLDED1; KE05
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001039712, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGGGCCTAAAGCGGCGGGCAAGCCAGGTGTGGCCAGAAGAGCATGGTGAGCAGGAACATGGGCTGT
  ACAGCCTGCACCGCATGTTTGACATCGTGGGCACTCATCTGACACACAGAGATGTGCGCGTGCTTTCTTT
  CCTCTTTGTTGATGTCATTGATGACCACGAGCGTGGACTCATCCGAAATGGACGTGACTTCTTATTGGCA
  CTGGAGCGCCAGGGCCGCTGTGATGAAAGTAACTTTCGCCAGGTGCTGCAGCTGCTGCGCATCATCACTC
  GCCACGACCTGCTGCCCTACGTCACCCTCAAGAGGAGACGGGCTGTGTGCCCTGATCTTGTAGACAAGTA
  TCTGGAGGAGACATCAATTCGCTATGTGACCCCCAGAGCCCTCAGTGATCCAGAACCAAGGCCTCCCCAG
  CCCTCTAAAACAGTGCCTCCCCACTATCCTGTGGTGTGTTGCCCCACTTCGGGTCCTCAGATGTGTAGCA
  AGCGGCCAGCCCGAGGGAGAGCCACACTTGGGAGCCAGCGAAAACGCCGGAAGTCAGTGACACCAGATCC
  CAAGGAGAAGCAGACATGTGACATCAGACTGCGGGTTCGGGCTGAATACTGCCAGCATGAGACTGCTCTG
  CAGGGCAATGTCTTCTCTAACAAGCAGGACCCACTTGAGCGCCAGTTTGAGCGCTTTAACCAGGCCAACA
  CCATCCTCAAGTCCCGGGACCTGGGCTCCATCATCTGTGACATCAAGTTCTCTGAGCTCACCTACCTCGA
  TGCATTCTGGCGTGACTACATCAATGGCTCTTTATTAGAGGCACTTAAAGGTGTCTTCATCACAGACTCC
  CTCAAGCAAGCTGTGGGCCATGAAGCCATCAAGCTGCTGGTAAATGTAGACGAGGAGGACTATGAGCTGG
  GCCGACAGAAACTCCTGAGGAACTTGATGCTGCAAGCATTGCCCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001039712
• ORF Size: 957 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001039712.1, NP_001034801.1
• RefSeq Size: 2300
• RefSeq ORF: 957
• Locus ID: 9191
• Protein Families: Druggable Genome, Transcription Factors
• Gene Summary: This gene encodes a protein that contains a death effector domain (DED). DED is a protein-protein interaction domain shared by adaptors, regulators and executors of the programmed cell death pathway. Overexpression of this gene was shown to induce weak apoptosis. Upon stimulation, this protein was found to translocate from cytoplasm to nucleus and colocalize with UBTF, a basal factor required for RNA polymerase I transcription, in the nucleolus. At least three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (4) differs in the 5' UTR and uses an alternate in-frame splice junction compared to variant 5. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform a. Variants 1, 3, and 4 all encode the same isoform (b).