PRPS2 (NM_001039091) Human Untagged Clone

CAT#: SC310842

PRPS2 (untagged)-Human phosphoribosyl pyrophosphate synthetase 2 (PRPS2), transcript variant 1


  "NM_001039091" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PRPS2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PRPS2
Synonyms PRSII
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001039091, the custom clone sequence may differ by one or more nucleotides


ATGCCCAACATCGTGCTGTTCAGCGGCAGCTCGCATCAGGACCTGTCCCAGCGCGTGGCCGACCGCCTGG
GCCTGGAGCTGGGCAAGGTGGTCACGAAGAAGTTCAGCAACCAGGAGACCAGCGTGGAGATTGGTGAAAG
CGTGAGAGGGGAAGATGTCTACATCATCCAGAGCGGCTGCGGGGAAATTAACGACAACCTGATGGAACTC
CTCATCATGATCAATGCCTGCAAGATTGCGTCATCATCCAGAGTAACTGCCGTGATCCCGTGTTTCCCAT
ACGCCCGACAAGATAAAAAGGACAAGGTAGGAGAGAGTCGTGCCCCAATTTCTGCAAAACTTGTGGCCAA
TATGCTGTCGGTGGCTGGGGCGGATCACATCATCACCATGGACCTGCATGCTTCTCAGATACAGGGATTC
TTTGATATTCCTGTGGATAATTTGTATGCGGAGCCCGCAGTCCTGCAGTGGATTCGGGAAAACATTGCCG
AGTGGAAGAACTGTATCATTGTTTCACCTGACGCAGGGGGAGCCAAAAGGGTTACATCAATTGCAGACAG
GTTGAATGTGGAATTTGCTTTGATCCACAAAGAGAGGAAGAAGGCGAATGAAGTGGACCGGATGGTCCTG
GTGGGCGACGTGAAGGACCGTGTGGCCATCCTCGTGGATGACATGGCTGACACTTGCGGCACCATCTGCC
ATGCTGCGGACAAGCTGCTGTCAGCTGGAGCCACCAAAGTGTATGCTATCCTTACCCATGGGATCTTCTC
TGGACCAGCTATTTCCAGAATAAATAATGCCGCCTTTGAGGCTGTTGTCGTCACAAACACAATTCCGCAA
GAGGACAAAATGAAACACTGCACCAAGATTCAGGTCATTGACATTTCCATGATCTTGGCCGAAGCAATCC
GAAGGACACACAATGGGGAATCCGTGTCCTACCTGTTCAGCCATGTCCCGCTATAA


Restriction Sites SgfI-MluI     
ACCN NM_001039091
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001039091.2, NP_001034180.1
RefSeq Size 2558 bp
RefSeq ORF 966 bp
Locus ID 5634
Cytogenetics Xp22.2
Protein Families Druggable Genome
Protein Pathways Metabolic pathways, Pentose phosphate pathway, Purine metabolism
Gene Summary 'This gene encodes a phosphoribosyl pyrophosphate synthetase that plays a central role in the synthesis of purines and pyrimidines. The encoded protein catalyzes the synthesis of 5-phosphoribosyl 1-pyrophosphate from ATP and D-ribose 5-phosphate. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]'
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.