ATP5MF (NM_001039178) Human Untagged Clone

CAT#: SC310856

ATP5J2 (untagged)-Human ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F2 (ATP5J2), nuclear gene encoding mitochondrial protein, transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ATP5MF
• Synonyms: ATP5J2; ATP5JL
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001039178, the custom clone sequence may differ by one or more nucleotides
  ATGGCGTCAGTTGTACCAGTGAAGGACAAGAAACTTCTGGAGGTCAAACTGGGGGAGCTG
  CCAAGCTGGATCTTGATGCGGGACTTCAGTCCTAGTGGCATTTTCGGAGCGTTTCAAAGA
  GAGCACGAGCGGCTCCGCAAATACCACTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001039178
• ORF Size: 150 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001039178.1, NP_001034267.1
• RefSeq Size: 377
• RefSeq ORF: 150
• Locus ID: 9551
• Protein Families: Transmembrane
• Protein Pathways: Metabolic pathways, Oxidative phosphorylation
• Gene Summary: Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. It is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, which comprises the proton channel. The catalytic portion of mitochondrial ATP synthase consists of five different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and single representatives of the gamma, delta, and epsilon subunits. The proton channel likely has nine subunits (a, b, c, d, e, f, g, F6 and 8). This gene encodes the f subunit of the Fo complex. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. This gene has multiple pseudogenes. Naturally occurring read-through transcription also exists between this gene and the downstream pentatricopeptide repeat domain 1 (PTCD1) gene. [provided by RefSeq, Nov 2010]
  Transcript Variant: This variant (4) uses an alternate in-frame splice site in the 5' coding region, and lacks an alternate in-frame exon in the 3' coding region, compared to variant 1. It encodes a shorter isoform (2d) that is missing multiple internal segments when compared to isoform 2a.