ATP6V1E1 (NM_001039367) Human Untagged Clone

CAT#: SC310913

ATP6V1E1 (untagged)-Human ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E1 (ATP6V1E1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ATP6V1E1
• Synonyms: ARCL2C; ATP6E; ATP6E2; ATP6V1E; P31; Vma4
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001039367, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCTCTCAGCGATGCTGACGTGCAAAAGCAGATAAAGCATATGATGGCTTTCATTGAACAAGAAGCCA
  ATGAGAAAGCAGAAGAAATAGATGCAAAGGCAGAAGAAGAGTTCAACATAGAGAAAGGTCGGCTTGTGCA
  AACCCAAAGACTAAAGATTATGGAATATTATGAGAAGAAAGAGAAACAGATTGAGCAGCAGAAGAAAATT
  CAGATGTCCAATTTGATGAATCAAGCGAGACTCAAAGTCCTCAGAGCAAGAGATGACCTTATCACAGGTT
  TGTACCAGTTGCTGGAGCCCCGAATGATTGTTCGTTGCAGGAAACAAGATTTCCCTCTGGTAAAGGCTGC
  AGTGCAGAAGGCAATTCCTATGTACAAAATTGCCACCAAAAACGATGTTGATGTCCAAATTGACCAGGAG
  TCCTACCTGCCTGAAGACATAGCTGGTGGAGTTGAGATCTATAATGGAGATCGTAAAATAAAGGTTTCCA
  ACACCCTGGAAAGCCGGCTGGATCTCATAGCCCAGCAGATGATGCCAGAAGTCCGGGGAGCCTTGTTTGG
  TGCAAATGCCAACAGGAAGTTTTTGGACTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001039367
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001039367.1, NP_001034456.1
• RefSeq Size: 1316 bp
• RefSeq ORF: 591 bp
• Locus ID: 529
• Cytogenetics: 22q11.21
• Protein Pathways: Epithelial cell signaling in Helicobacter pylori infection, Metabolic pathways, Oxidative phosphorylation, Vibrio cholerae infection
• Gene Summary: 'This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A, three B, and two G subunits, as well as a C, D, E, F, and H subunit. The V1 domain contains the ATP catalytic site. This gene encodes alternate transcriptional splice variants, encoding different V1 domain E subunit isoforms. Pseudogenes for this gene have been found in the genome. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (3) lacks an alternate in-frame exon, compared to variant 1, resulting in a shorter protein (isoform c), compared to isoform a.